Incidental Mutation 'R6196:Or1e16'
ID 502931
Institutional Source Beutler Lab
Gene Symbol Or1e16
Ensembl Gene ENSMUSG00000069823
Gene Name olfactory receptor family 1 subfamily E member 16
Synonyms GA_x6K02T2P1NL-3556334-3555390, MOR135-13, I54, Olfr1
MMRRC Submission 044336-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R6196 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 73285902-73290321 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 73286299 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 183 (A183V)
Ref Sequence ENSEMBL: ENSMUSP00000113707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120303] [ENSMUST00000131253] [ENSMUST00000134011]
AlphaFold Q8VGI1
Predicted Effect probably benign
Transcript: ENSMUST00000120303
AA Change: A183V

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113707
Gene: ENSMUSG00000069823
AA Change: A183V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.7e-60 PFAM
Pfam:7tm_1 41 290 2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131253
AA Change: A183V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000120899
Gene: ENSMUSG00000069823
AA Change: A183V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 31 184 1.2e-6 PFAM
Pfam:7TM_GPCR_Srsx 35 171 6.1e-8 PFAM
Pfam:7tm_1 41 191 3.6e-30 PFAM
Pfam:7tm_4 139 196 1.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134011
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A T 8: 106,436,554 (GRCm39) H241L possibly damaging Het
Acap1 T C 11: 69,777,893 (GRCm39) D115G probably damaging Het
Acvr2b T C 9: 119,262,469 (GRCm39) V510A possibly damaging Het
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Agr2 A T 12: 36,045,591 (GRCm39) K26* probably null Het
Aox4 T A 1: 58,256,685 (GRCm39) I69N probably damaging Het
Asb4 G A 6: 5,390,699 (GRCm39) G31R probably benign Het
Atp6v1c2 C A 12: 17,351,187 (GRCm39) E105* probably null Het
Bend6 A G 1: 33,917,509 (GRCm39) Y44H probably damaging Het
Bltp3b T G 10: 89,641,195 (GRCm39) S789A probably benign Het
Btn2a2 C T 13: 23,672,015 (GRCm39) V25M possibly damaging Het
Cab39l T A 14: 59,737,039 (GRCm39) L53Q probably damaging Het
Cc2d1b C T 4: 108,490,422 (GRCm39) R825W probably damaging Het
Cdc14b C T 13: 64,353,338 (GRCm39) probably benign Het
Cenpu A G 8: 47,015,615 (GRCm39) R177G probably benign Het
Chit1 C A 1: 134,074,381 (GRCm39) Y229* probably null Het
Crybg2 C A 4: 133,808,450 (GRCm39) S1350R probably damaging Het
Ctdspl2 A G 2: 121,809,373 (GRCm39) probably null Het
Ctsr A T 13: 61,308,345 (GRCm39) H266Q probably benign Het
Dynlt5 A G 4: 102,849,766 (GRCm39) E63G possibly damaging Het
Efcab3 T G 11: 104,746,386 (GRCm39) I2279S probably benign Het
Extl3 T A 14: 65,313,584 (GRCm39) M533L probably benign Het
Fam162b C A 10: 51,463,506 (GRCm39) probably null Het
Fbxo28 T C 1: 182,157,454 (GRCm39) K121R probably damaging Het
Fsip2 A C 2: 82,820,227 (GRCm39) E5320A possibly damaging Het
Galc A T 12: 98,225,421 (GRCm39) D56E probably damaging Het
Gm5468 A G 15: 25,414,481 (GRCm39) probably benign Het
Hk1 T A 10: 62,135,038 (GRCm39) H24L probably damaging Het
Igkv5-43 A G 6: 69,752,965 (GRCm39) V39A possibly damaging Het
Lemd2 G A 17: 27,411,976 (GRCm39) Q439* probably null Het
Lgi1 A G 19: 38,294,257 (GRCm39) N295S probably benign Het
Macc1 T G 12: 119,409,785 (GRCm39) S184R probably damaging Het
Msmo1 A G 8: 65,180,918 (GRCm39) probably benign Het
Muc5b C A 7: 141,405,333 (GRCm39) R914S unknown Het
Or10d1 G A 9: 39,483,776 (GRCm39) P260S possibly damaging Het
Or1e17 G A 11: 73,831,635 (GRCm39) A188T possibly damaging Het
Or4k2 C A 14: 50,424,135 (GRCm39) D180Y probably damaging Het
Or5b110-ps1 A G 19: 13,260,290 (GRCm39) I44T probably benign Het
Plekha5 T C 6: 140,525,179 (GRCm39) S14P probably benign Het
Pus10 A G 11: 23,622,638 (GRCm39) K86R probably benign Het
Rab37 T C 11: 115,051,132 (GRCm39) V147A probably benign Het
Sin3a T A 9: 57,011,213 (GRCm39) I490N probably damaging Het
Slc27a4 A G 2: 29,695,762 (GRCm39) D99G probably benign Het
Slc43a2 C T 11: 75,459,206 (GRCm39) R413* probably null Het
Syna G T 5: 134,588,466 (GRCm39) T161N probably benign Het
T A G 17: 8,655,996 (GRCm39) D86G possibly damaging Het
Tanc1 G A 2: 59,674,366 (GRCm39) E1817K possibly damaging Het
Tap2 C A 17: 34,433,384 (GRCm39) Q516K possibly damaging Het
Tcaf1 A T 6: 42,653,741 (GRCm39) D717E probably damaging Het
Tcf20 G T 15: 82,736,187 (GRCm39) Q1755K possibly damaging Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Trpm7 G A 2: 126,667,559 (GRCm39) P811S possibly damaging Het
Vmn2r59 A G 7: 41,661,679 (GRCm39) V712A probably benign Het
Vwc2l T A 1: 70,768,180 (GRCm39) D34E probably damaging Het
Wdr35 A G 12: 9,077,632 (GRCm39) K1091E probably benign Het
Other mutations in Or1e16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Or1e16 APN 11 73,286,017 (GRCm39) missense probably damaging 0.98
IGL01938:Or1e16 APN 11 73,286,471 (GRCm39) missense probably damaging 1.00
IGL02270:Or1e16 APN 11 73,286,191 (GRCm39) missense probably benign
IGL03287:Or1e16 APN 11 73,286,845 (GRCm39) start codon destroyed probably null 1.00
R0006:Or1e16 UTSW 11 73,286,314 (GRCm39) missense probably damaging 0.99
R0907:Or1e16 UTSW 11 73,285,945 (GRCm39) missense probably damaging 0.97
R1982:Or1e16 UTSW 11 73,285,918 (GRCm39) missense probably benign 0.00
R3804:Or1e16 UTSW 11 73,286,776 (GRCm39) missense probably benign 0.01
R4064:Or1e16 UTSW 11 73,286,348 (GRCm39) missense probably benign 0.04
R4171:Or1e16 UTSW 11 73,286,365 (GRCm39) missense probably damaging 1.00
R4724:Or1e16 UTSW 11 73,285,981 (GRCm39) missense probably damaging 1.00
R4732:Or1e16 UTSW 11 73,286,521 (GRCm39) missense probably benign 0.03
R4733:Or1e16 UTSW 11 73,286,521 (GRCm39) missense probably benign 0.03
R5030:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5097:Or1e16 UTSW 11 73,286,119 (GRCm39) missense probably damaging 1.00
R5098:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5101:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5135:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5137:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5192:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5193:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5193:Or1e16 UTSW 11 73,286,479 (GRCm39) frame shift probably null
R5197:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5220:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5221:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5222:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5258:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5297:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5396:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5398:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5399:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5432:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5433:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5531:Or1e16 UTSW 11 73,286,003 (GRCm39) missense probably benign 0.26
R5634:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5714:Or1e16 UTSW 11 73,286,187 (GRCm39) splice site probably null
R5812:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5813:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5814:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5815:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5913:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5955:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5956:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5968:Or1e16 UTSW 11 73,286,018 (GRCm39) missense possibly damaging 0.75
R6029:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6034:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6034:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6176:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6177:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6178:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6995:Or1e16 UTSW 11 73,286,410 (GRCm39) missense probably benign
R7035:Or1e16 UTSW 11 73,286,544 (GRCm39) missense probably benign 0.00
R7470:Or1e16 UTSW 11 73,286,714 (GRCm39) missense probably damaging 1.00
R7530:Or1e16 UTSW 11 73,279,189 (GRCm39) missense possibly damaging 0.55
R8461:Or1e16 UTSW 11 73,285,982 (GRCm39) missense probably damaging 1.00
R9149:Or1e16 UTSW 11 73,286,853 (GRCm39) unclassified probably benign
R9279:Or1e16 UTSW 11 73,279,789 (GRCm39) missense probably benign 0.05
R9293:Or1e16 UTSW 11 73,285,955 (GRCm39) missense probably damaging 0.99
R9682:Or1e16 UTSW 11 73,286,025 (GRCm39) missense probably benign 0.03
R9752:Or1e16 UTSW 11 73,286,479 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CTGTCCCATAGAACAGTGACAC -3'
(R):5'- CGCTATGTGGCCATCTGTTACC -3'

Sequencing Primer
(F):5'- TGACACTACAGACAGGTGAGATCC -3'
(R):5'- CCCCTTCATTACACCACCATCATG -3'
Posted On 2018-02-27