Incidental Mutation 'R6198:Adam19'
ID503052
Institutional Source Beutler Lab
Gene Symbol Adam19
Ensembl Gene ENSMUSG00000011256
Gene Namea disintegrin and metallopeptidase domain 19 (meltrin beta)
SynonymsMltnb
MMRRC Submission 044338-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6198 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location46055992-46147343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 46121502 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 275 (N275T)
Ref Sequence ENSEMBL: ENSMUSP00000011400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011400]
Predicted Effect probably damaging
Transcript: ENSMUST00000011400
AA Change: N275T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000011400
Gene: ENSMUSG00000011256
AA Change: N275T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Pep_M12B_propep 32 163 9.4e-27 PFAM
Pfam:Reprolysin_5 209 388 1.9e-25 PFAM
Pfam:Reprolysin_4 209 399 1.5e-15 PFAM
Pfam:Reprolysin 211 409 1.3e-68 PFAM
Pfam:Reprolysin_2 231 399 6.1e-19 PFAM
Pfam:Reprolysin_3 235 357 1.2e-19 PFAM
DISIN 426 501 9.7e-41 SMART
ACR 502 650 7.46e-62 SMART
transmembrane domain 704 726 N/A INTRINSIC
low complexity region 788 797 N/A INTRINSIC
low complexity region 832 846 N/A INTRINSIC
low complexity region 886 905 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: This gene encodes a cell surface glycoprotein and member of the ADAM (a disintegrin and metalloproteinase) family of endopeptidases. The encoded protein may play a role in the ectodomain shedding of neuregulin proteins. Homozygous knockout mice for this gene exhibit heart development defects and perinatal lethality. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that undergoes proteolytic processing to generate a mature protein product. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice exhibit cardiac developmental defects and die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,416,850 probably null Het
1700061G19Rik A G 17: 56,882,679 S265G probably damaging Het
2610318N02Rik A G 16: 17,118,369 S164P probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrg7 T A 16: 56,777,193 T84S possibly damaging Het
Asl C T 5: 130,018,916 V70I probably benign Het
Atp2c1 A G 9: 105,521,072 S26P probably benign Het
Bcas3 A T 11: 85,509,435 D410V probably damaging Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Ccdc15 A C 9: 37,314,285 probably null Het
Cfh A G 1: 140,105,440 S789P probably damaging Het
Cltc T C 11: 86,720,362 N561S probably benign Het
Cnst A G 1: 179,592,865 Q187R probably damaging Het
Csmd3 T C 15: 48,313,877 T422A probably benign Het
Cyp2c55 A T 19: 39,007,121 R26* probably null Het
Dgkb A T 12: 38,173,823 M414L probably benign Het
Dgkd A G 1: 87,924,208 D444G probably damaging Het
Dnmt3c T C 2: 153,720,009 V544A noncoding transcript Het
Dus3l A T 17: 56,767,858 T327S possibly damaging Het
Elf2 A T 3: 51,277,249 L5Q probably damaging Het
Fam69b A G 2: 26,635,698 K215E probably damaging Het
Fxyd6 A G 9: 45,390,670 Y30C probably damaging Het
Gcc2 A T 10: 58,292,590 T1375S probably benign Het
Git2 A T 5: 114,745,495 Y393* probably null Het
Gm14403 AAACCCTA AA 2: 177,509,655 probably benign Het
Gm9573 T A 17: 35,620,916 probably benign Het
Golgb1 T C 16: 36,893,395 L246P probably damaging Het
Grp G T 18: 65,879,986 Q74H possibly damaging Het
Ifi203 A T 1: 173,924,082 M391K probably damaging Het
Itih2 A G 2: 10,098,541 Y712H probably benign Het
Kdm5a T A 6: 120,438,997 V1626E probably benign Het
Klhl40 A G 9: 121,778,767 Y331C probably damaging Het
Kprp T A 3: 92,824,687 Y352F probably damaging Het
Lama2 G T 10: 27,188,022 H1286Q probably damaging Het
Lgi4 T A 7: 31,069,122 probably null Het
Lrrc47 A T 4: 154,015,672 N235I probably damaging Het
Lrrc74b T A 16: 17,548,786 I308F probably damaging Het
Map7d1 T A 4: 126,241,843 K135M probably damaging Het
March5 A G 19: 37,210,741 R36G probably damaging Het
Mtx3 C A 13: 92,852,851 P299Q probably benign Het
Ncapd2 C A 6: 125,179,323 E500* probably null Het
Nckap5l T C 15: 99,425,988 K878R probably damaging Het
Nphs1 T C 7: 30,467,915 I756T probably damaging Het
Olfm4 T G 14: 80,000,373 S17A probably benign Het
Olfr1270 A T 2: 90,149,438 D189E probably damaging Het
Olfr344 A G 2: 36,568,951 M118V probably damaging Het
Pak1ip1 G T 13: 41,001,410 Q27H probably benign Het
Piezo2 A T 18: 63,157,210 C159* probably null Het
Pkn2 G T 3: 142,810,404 T538K probably benign Het
Ppp3cc A T 14: 70,247,611 M198K probably benign Het
Rrm1 T G 7: 102,446,729 probably null Het
Setd3 T C 12: 108,165,168 K7E possibly damaging Het
Shc1 A G 3: 89,422,107 K86R probably benign Het
Slc16a7 T C 10: 125,228,215 T418A probably benign Het
Spocd1 C T 4: 129,955,415 P676S probably damaging Het
Spp1 A G 5: 104,439,508 probably null Het
Syne1 A G 10: 5,302,269 Y2462H probably damaging Het
Tiam2 T C 17: 3,414,121 S42P probably benign Het
Tmem63b C T 17: 45,661,516 V722I probably benign Het
Ubqln1 A G 13: 58,196,590 S130P probably benign Het
Usp34 G T 11: 23,484,127 L3215F probably damaging Het
Uvssa A G 5: 33,409,510 Y517C probably damaging Het
Vps13d A T 4: 145,148,990 F1649Y probably benign Het
Zfp236 A G 18: 82,657,153 S405P probably damaging Het
Zfp9 T C 6: 118,477,321 M1V probably null Het
Zfp946 A T 17: 22,454,915 S217C probably damaging Het
Zfp970 T A 2: 177,475,460 C276S probably damaging Het
Zswim5 T A 4: 116,878,007 F183Y probably benign Het
Other mutations in Adam19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Adam19 APN 11 46112783 missense probably damaging 1.00
IGL01727:Adam19 APN 11 46121553 missense probably benign
IGL01758:Adam19 APN 11 46112924 missense probably benign 0.01
IGL02160:Adam19 APN 11 46139695 missense probably damaging 0.99
IGL02421:Adam19 APN 11 46137553 missense probably damaging 0.96
IGL02572:Adam19 APN 11 46131721 nonsense probably null
IGL02995:Adam19 APN 11 46136349 missense probably benign 0.00
IGL03171:Adam19 APN 11 46138854 missense probably damaging 0.98
IGL03237:Adam19 APN 11 46137556 missense probably benign
R0003:Adam19 UTSW 11 46128789 missense probably damaging 1.00
R0026:Adam19 UTSW 11 46136259 missense probably damaging 1.00
R0158:Adam19 UTSW 11 46143034 missense probably damaging 1.00
R0304:Adam19 UTSW 11 46127392 missense possibly damaging 0.91
R0488:Adam19 UTSW 11 46138930 missense probably damaging 0.98
R0501:Adam19 UTSW 11 46123130 missense probably damaging 1.00
R0591:Adam19 UTSW 11 46121411 splice site probably benign
R0734:Adam19 UTSW 11 46127403 missense probably damaging 0.99
R0747:Adam19 UTSW 11 46118495 splice site probably null
R0771:Adam19 UTSW 11 46121453 missense possibly damaging 0.92
R1052:Adam19 UTSW 11 46127265 missense probably damaging 0.99
R1573:Adam19 UTSW 11 46113618 splice site probably benign
R1735:Adam19 UTSW 11 46138917 missense probably benign 0.26
R1830:Adam19 UTSW 11 46127278 missense probably damaging 0.98
R1911:Adam19 UTSW 11 46121454 missense probably damaging 1.00
R2092:Adam19 UTSW 11 46060904 intron probably null
R3749:Adam19 UTSW 11 46137610 missense probably benign 0.00
R3893:Adam19 UTSW 11 46128838 missense probably damaging 1.00
R3916:Adam19 UTSW 11 46060935 missense probably benign 0.25
R3917:Adam19 UTSW 11 46060935 missense probably benign 0.25
R4506:Adam19 UTSW 11 46118444 missense possibly damaging 0.67
R4767:Adam19 UTSW 11 46138977 critical splice donor site probably null
R5055:Adam19 UTSW 11 46123169 missense probably damaging 1.00
R5313:Adam19 UTSW 11 46131776 missense probably damaging 1.00
R5329:Adam19 UTSW 11 46125026 missense probably damaging 0.99
R5567:Adam19 UTSW 11 46136250 missense probably damaging 1.00
R5602:Adam19 UTSW 11 46136315 missense probably benign
R6875:Adam19 UTSW 11 46112875 missense probably benign
R7011:Adam19 UTSW 11 46143018 missense probably benign 0.00
R7163:Adam19 UTSW 11 46131717 missense probably benign
R7213:Adam19 UTSW 11 46121471 missense probably benign 0.20
R7267:Adam19 UTSW 11 46121576 nonsense probably null
X0067:Adam19 UTSW 11 46056115 start codon destroyed probably null 0.06
Predicted Primers PCR Primer
(F):5'- TTGACCACCAGAATGCATCC -3'
(R):5'- CAACATTGGCCCCTGTGAAAG -3'

Sequencing Primer
(F):5'- AGAATGCATCCCTCTGAAGGTCG -3'
(R):5'- CTGTGAAAGGAAGGGTGAATTTCGC -3'
Posted On2018-02-27