Incidental Mutation 'R6199:Gsdmc2'
ID503119
Institutional Source Beutler Lab
Gene Symbol Gsdmc2
Ensembl Gene ENSMUSG00000056293
Gene Namegasdermin C2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R6199 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location63824346-63845177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63825113 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 403 (I403T)
Ref Sequence ENSEMBL: ENSMUSP00000140487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089900] [ENSMUST00000188404] [ENSMUST00000188691]
Predicted Effect probably benign
Transcript: ENSMUST00000089900
AA Change: I403T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000087344
Gene: ENSMUSG00000056293
AA Change: I403T

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 1.8e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185277
Predicted Effect probably benign
Transcript: ENSMUST00000188404
AA Change: I403T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000141066
Gene: ENSMUSG00000056293
AA Change: I403T

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 1.7e-148 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188691
AA Change: I403T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000140487
Gene: ENSMUSG00000056293
AA Change: I403T

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 1.7e-148 PFAM
Meta Mutation Damage Score 0.24 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 A T 12: 88,441,117 D206V possibly damaging Het
Ank2 T A 3: 127,004,006 D685V probably damaging Het
Baz2b A G 2: 59,978,675 S77P probably benign Het
C430049E01Rik T C 8: 71,525,465 N83D probably benign Het
Ceacam5 A T 7: 17,714,885 T59S probably benign Het
Ces1e A C 8: 93,217,535 F218L probably damaging Het
Cps1 TGTCCATTGGTC TGTC 1: 67,162,615 probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Eftud2 A T 11: 102,840,057 V843E probably damaging Het
Fuca2 G T 10: 13,506,039 W232L probably damaging Het
Gdf7 T C 12: 8,298,832 D155G unknown Het
Ggcx G T 6: 72,430,139 V753F possibly damaging Het
Ghrhr A T 6: 55,379,188 T89S probably benign Het
Gpr151 T C 18: 42,578,554 K353R probably benign Het
Gpr75 T C 11: 30,891,527 L144P probably damaging Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Ick T C 9: 78,164,639 V531A probably benign Het
Igsf5 C T 16: 96,421,739 S61L possibly damaging Het
Insc A T 7: 114,791,166 probably null Het
Izumo4 G A 10: 80,702,873 G53D probably damaging Het
Ksr1 G A 11: 79,020,441 P693S possibly damaging Het
Lgals4 G A 7: 28,835,892 R27H probably damaging Het
Lpcat2b A G 5: 107,433,305 R167G probably benign Het
Man1a C T 10: 54,014,456 V288I possibly damaging Het
Map2 T G 1: 66,425,478 S1676A probably damaging Het
Mbl1 G T 14: 41,153,615 V9F unknown Het
Mrgprb8 T A 7: 48,389,303 C241S probably benign Het
Mrpl2 T C 17: 46,649,086 L227P probably damaging Het
Mthfd1 T A 12: 76,288,911 V253E probably damaging Het
Mthfd1 A G 12: 76,303,680 H464R probably damaging Het
Mug2 T A 6: 122,047,439 M490K probably benign Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Notch1 A G 2: 26,469,899 V1268A probably damaging Het
Olfr1415 A T 1: 92,491,542 I71N possibly damaging Het
Olfr876 C A 9: 37,804,881 probably null Het
Pgm2 A T 4: 99,978,954 I412F probably damaging Het
Plaur A T 7: 24,465,203 Q44L possibly damaging Het
Ppara T C 15: 85,787,233 Y112H probably damaging Het
Ppm1h G A 10: 122,920,739 V430M probably damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Prph A G 15: 99,056,832 T35A probably benign Het
Prrc2c C T 1: 162,682,516 G780S probably damaging Het
Ptchd3 T A 11: 121,831,082 N260K probably benign Het
Ptprz1 A G 6: 23,002,471 D1520G probably benign Het
Samd9l T A 6: 3,376,686 I192L probably benign Het
Slc39a10 T C 1: 46,835,833 D103G probably damaging Het
Smndc1 G A 19: 53,383,632 T117M probably benign Het
Tesk2 A G 4: 116,792,170 D159G probably damaging Het
Tmem2 G A 19: 21,844,822 G1194S probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn2r108 A T 17: 20,462,382 N853K probably benign Het
Wdfy3 C T 5: 101,872,965 R2491Q possibly damaging Het
Other mutations in Gsdmc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Gsdmc2 APN 15 63828271 splice site probably benign
IGL02212:Gsdmc2 APN 15 63828062 splice site probably benign
IGL02394:Gsdmc2 APN 15 63835880 missense probably damaging 1.00
IGL02683:Gsdmc2 APN 15 63833412 missense probably damaging 1.00
R0046:Gsdmc2 UTSW 15 63827755 splice site probably benign
R0105:Gsdmc2 UTSW 15 63828177 missense probably benign
R0105:Gsdmc2 UTSW 15 63828177 missense probably benign
R0655:Gsdmc2 UTSW 15 63827773 missense probably benign 0.00
R1066:Gsdmc2 UTSW 15 63825050 missense possibly damaging 0.92
R1283:Gsdmc2 UTSW 15 63825057 missense probably damaging 0.99
R1691:Gsdmc2 UTSW 15 63833465 missense probably damaging 1.00
R1727:Gsdmc2 UTSW 15 63849779 unclassified probably benign
R1911:Gsdmc2 UTSW 15 63827772 missense probably benign 0.00
R1990:Gsdmc2 UTSW 15 63828237 missense probably benign 0.00
R1991:Gsdmc2 UTSW 15 63828237 missense probably benign 0.00
R2018:Gsdmc2 UTSW 15 63828126 intron probably null
R2090:Gsdmc2 UTSW 15 63826826 missense probably benign 0.09
R3037:Gsdmc2 UTSW 15 63833331 missense probably benign 0.00
R3964:Gsdmc2 UTSW 15 63849834 unclassified probably benign
R4308:Gsdmc2 UTSW 15 63848705 unclassified probably benign
R4574:Gsdmc2 UTSW 15 63828023 critical splice donor site probably null
R4738:Gsdmc2 UTSW 15 63826801 nonsense probably null
R4873:Gsdmc2 UTSW 15 63828252 missense probably benign 0.41
R4875:Gsdmc2 UTSW 15 63828252 missense probably benign 0.41
R4883:Gsdmc2 UTSW 15 63835765 missense probably damaging 1.00
R5115:Gsdmc2 UTSW 15 63827768 missense probably benign 0.00
R5241:Gsdmc2 UTSW 15 63824894 missense probably benign 0.00
R5510:Gsdmc2 UTSW 15 63828196 missense probably benign
R5841:Gsdmc2 UTSW 15 63826210 missense probably benign 0.00
R5987:Gsdmc2 UTSW 15 63830866 missense probably benign 0.00
R6359:Gsdmc2 UTSW 15 63825017 missense probably damaging 1.00
R6610:Gsdmc2 UTSW 15 63825008 missense probably benign 0.03
R6984:Gsdmc2 UTSW 15 63825049 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATGACAGGCTTCCATAGAGAGC -3'
(R):5'- CACACCGGCAGATGATACTC -3'

Sequencing Primer
(F):5'- CAGACAGGGGCATTTTGGC -3'
(R):5'- ACACCGGCAGATGATACTCTTGTG -3'
Posted On2018-02-27