Incidental Mutation 'R6199:Ppara'
ID503120
Institutional Source Beutler Lab
Gene Symbol Ppara
Ensembl Gene ENSMUSG00000022383
Gene Nameperoxisome proliferator activated receptor alpha
SynonymsPpar, Nr1c1, PPAR-alpha, PPARalpha, 4933429D07Rik
MMRRC Submission 044339-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6199 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location85734983-85802819 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85787233 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 112 (Y112H)
Ref Sequence ENSEMBL: ENSMUSP00000105050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057979] [ENSMUST00000109422] [ENSMUST00000109423]
Predicted Effect probably damaging
Transcript: ENSMUST00000057979
AA Change: Y112H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000059719
Gene: ENSMUSG00000022383
AA Change: Y112H

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 73 89 N/A INTRINSIC
ZnF_C4 99 169 2.27e-34 SMART
HOLI 278 437 2.8e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109422
AA Change: Y112H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105049
Gene: ENSMUSG00000022383
AA Change: Y112H

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 73 89 N/A INTRINSIC
ZnF_C4 99 169 2.27e-34 SMART
HOLI 278 437 2.8e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109423
AA Change: Y112H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105050
Gene: ENSMUSG00000022383
AA Change: Y112H

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 73 89 N/A INTRINSIC
ZnF_C4 99 169 2.27e-34 SMART
HOLI 278 437 2.8e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Peroxisome proliferators include hypolipidemic drugs, herbicides, leukotriene antagonists, and plasticizers; this term arises because they induce an increase in the size and number of peroxisomes. Peroxisomes are subcellular organelles found in plants and animals that contain enzymes for respiration and for cholesterol and lipid metabolism. The action of peroxisome proliferators is thought to be mediated via specific receptors, called PPARs, which belong to the steroid hormone receptor superfamily. PPARs affect the expression of target genes involved in cell proliferation, cell differentiation and in immune and inflammation responses. Three closely related subtypes (alpha, beta/delta, and gamma) have been identified. This gene encodes the subtype PPAR-alpha, which is a nuclear transcription factor. Multiple alternatively spliced transcript variants have been described for this gene, although the full-length nature of only two has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit loss of diurnal variation in hepatic fatty acid and cholesterol synthesis, increased hepatic lipid and gonadal adipose stores, impaired skin wound healing, and altered metabolic responses to starvation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 A T 12: 88,441,117 D206V possibly damaging Het
Ank2 T A 3: 127,004,006 D685V probably damaging Het
Baz2b A G 2: 59,978,675 S77P probably benign Het
C430049E01Rik T C 8: 71,525,465 N83D probably benign Het
Ceacam5 A T 7: 17,714,885 T59S probably benign Het
Ces1e A C 8: 93,217,535 F218L probably damaging Het
Cps1 TGTCCATTGGTC TGTC 1: 67,162,615 probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Eftud2 A T 11: 102,840,057 V843E probably damaging Het
Fuca2 G T 10: 13,506,039 W232L probably damaging Het
Gdf7 T C 12: 8,298,832 D155G unknown Het
Ggcx G T 6: 72,430,139 V753F possibly damaging Het
Ghrhr A T 6: 55,379,188 T89S probably benign Het
Gpr151 T C 18: 42,578,554 K353R probably benign Het
Gpr75 T C 11: 30,891,527 L144P probably damaging Het
Gsdmc2 A G 15: 63,825,113 I403T probably benign Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Ick T C 9: 78,164,639 V531A probably benign Het
Igsf5 C T 16: 96,421,739 S61L possibly damaging Het
Insc A T 7: 114,791,166 probably null Het
Izumo4 G A 10: 80,702,873 G53D probably damaging Het
Ksr1 G A 11: 79,020,441 P693S possibly damaging Het
Lgals4 G A 7: 28,835,892 R27H probably damaging Het
Lpcat2b A G 5: 107,433,305 R167G probably benign Het
Man1a C T 10: 54,014,456 V288I possibly damaging Het
Map2 T G 1: 66,425,478 S1676A probably damaging Het
Mbl1 G T 14: 41,153,615 V9F unknown Het
Mrgprb8 T A 7: 48,389,303 C241S probably benign Het
Mrpl2 T C 17: 46,649,086 L227P probably damaging Het
Mthfd1 T A 12: 76,288,911 V253E probably damaging Het
Mthfd1 A G 12: 76,303,680 H464R probably damaging Het
Mug2 T A 6: 122,047,439 M490K probably benign Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Notch1 A G 2: 26,469,899 V1268A probably damaging Het
Olfr1415 A T 1: 92,491,542 I71N possibly damaging Het
Olfr876 C A 9: 37,804,881 probably null Het
Pgm2 A T 4: 99,978,954 I412F probably damaging Het
Plaur A T 7: 24,465,203 Q44L possibly damaging Het
Ppm1h G A 10: 122,920,739 V430M probably damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Prph A G 15: 99,056,832 T35A probably benign Het
Prrc2c C T 1: 162,682,516 G780S probably damaging Het
Ptchd3 T A 11: 121,831,082 N260K probably benign Het
Ptprz1 A G 6: 23,002,471 D1520G probably benign Het
Samd9l T A 6: 3,376,686 I192L probably benign Het
Slc39a10 T C 1: 46,835,833 D103G probably damaging Het
Smndc1 G A 19: 53,383,632 T117M probably benign Het
Tesk2 A G 4: 116,792,170 D159G probably damaging Het
Tmem2 G A 19: 21,844,822 G1194S probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn2r108 A T 17: 20,462,382 N853K probably benign Het
Wdfy3 C T 5: 101,872,965 R2491Q possibly damaging Het
Other mutations in Ppara
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Ppara APN 15 85801067 missense probably benign 0.00
IGL00754:Ppara APN 15 85777642 missense probably damaging 0.99
IGL01409:Ppara APN 15 85777643 missense probably damaging 0.98
IGL02080:Ppara APN 15 85789019 missense possibly damaging 0.74
IGL02442:Ppara APN 15 85801143 missense probably benign 0.19
IGL02810:Ppara APN 15 85777677 missense probably damaging 0.99
IGL02852:Ppara APN 15 85797878 missense probably benign 0.00
R0333:Ppara UTSW 15 85790960 missense probably damaging 1.00
R0551:Ppara UTSW 15 85787105 splice site probably benign
R0883:Ppara UTSW 15 85798171 missense probably damaging 1.00
R1125:Ppara UTSW 15 85789055 missense possibly damaging 0.71
R1189:Ppara UTSW 15 85798164 missense probably benign 0.04
R1233:Ppara UTSW 15 85798021 missense probably damaging 1.00
R1582:Ppara UTSW 15 85798228 missense possibly damaging 0.69
R1755:Ppara UTSW 15 85797979 missense probably benign 0.14
R1913:Ppara UTSW 15 85801099 missense probably damaging 1.00
R2163:Ppara UTSW 15 85801046 missense probably benign 0.04
R4570:Ppara UTSW 15 85787197 missense probably benign 0.02
R4980:Ppara UTSW 15 85787233 missense probably damaging 0.99
R5117:Ppara UTSW 15 85777761 missense probably benign 0.00
R5749:Ppara UTSW 15 85789028 missense probably benign 0.35
R6221:Ppara UTSW 15 85777680 missense probably benign 0.02
R6624:Ppara UTSW 15 85791036 missense probably benign 0.24
R7382:Ppara UTSW 15 85787228 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTAACACCCCAGGTTTCAC -3'
(R):5'- GAATATGCGCCTCTCAGATGTC -3'

Sequencing Primer
(F):5'- AACACCCCAGGTTTCACATACTTTC -3'
(R):5'- TATGCGCCTCTCAGATGTCTACAAAG -3'
Posted On2018-02-27