Incidental Mutation 'R6200:Gm4788'
ID503131
Institutional Source Beutler Lab
Gene Symbol Gm4788
Ensembl Gene ENSMUSG00000070594
Gene Namepredicted gene 4788
Synonyms
MMRRC Submission 044340-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R6200 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location139697623-139781243 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139754335 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 174 (R174S)
Ref Sequence ENSEMBL: ENSMUSP00000107620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027612] [ENSMUST00000111986] [ENSMUST00000111989]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027612
AA Change: R174S

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027612
Gene: ENSMUSG00000070594
AA Change: R174S

DomainStartEndE-ValueType
CCP 28 88 1.65e-2 SMART
CCP 92 145 1.15e-10 SMART
CCP 151 208 5.65e-10 SMART
CCP 212 267 1.12e-4 SMART
CCP 272 325 4.52e-9 SMART
CCP 332 386 9.1e-14 SMART
CCP 393 446 1.58e-13 SMART
CCP 455 505 4.92e-1 SMART
CCP 511 564 8.9e-8 SMART
CCP 569 622 4.18e-13 SMART
CCP 627 681 3.5e-15 SMART
CCP 688 742 5.69e-15 SMART
CCP 746 807 2.77e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111986
AA Change: R174S

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107617
Gene: ENSMUSG00000070594
AA Change: R174S

DomainStartEndE-ValueType
CCP 28 88 1.65e-2 SMART
CCP 92 145 1.15e-10 SMART
CCP 151 208 5.65e-10 SMART
CCP 212 267 1.12e-4 SMART
CCP 272 325 4.52e-9 SMART
CCP 333 387 9.1e-14 SMART
CCP 394 447 1.58e-13 SMART
CCP 456 506 4.92e-1 SMART
CCP 512 565 8.9e-8 SMART
CCP 571 635 2.66e-6 SMART
CCP 640 693 4.18e-13 SMART
CCP 700 754 5.69e-15 SMART
CCP 758 819 2.77e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111989
AA Change: R174S

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107620
Gene: ENSMUSG00000070594
AA Change: R174S

DomainStartEndE-ValueType
CCP 28 88 1.65e-2 SMART
CCP 92 145 1.15e-10 SMART
CCP 151 208 5.65e-10 SMART
CCP 212 267 1.12e-4 SMART
CCP 272 325 4.52e-9 SMART
CCP 333 387 9.1e-14 SMART
CCP 394 447 1.58e-13 SMART
CCP 456 506 4.92e-1 SMART
CCP 512 565 8.9e-8 SMART
CCP 571 635 2.66e-6 SMART
CCP 640 693 4.18e-13 SMART
CCP 698 752 3.5e-15 SMART
CCP 759 813 5.69e-15 SMART
CCP 817 878 2.77e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 91% (32/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,090,050 Y54C probably damaging Het
Ash1l A G 3: 89,070,527 H2719R probably damaging Het
Atraid A G 5: 31,052,866 N127D probably damaging Het
Capzb T C 4: 139,280,013 V145A probably benign Het
Cldn17 A C 16: 88,506,571 L90R probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Fancc A C 13: 63,360,248 L158V probably damaging Het
Fcamr T C 1: 130,803,190 L60P probably benign Het
G6pd2 C T 5: 61,809,871 R330C probably benign Het
Gm16432 A G 1: 178,111,558 N666D possibly damaging Het
Gpr158 A T 2: 21,399,416 N333I probably damaging Het
Herpud2 A G 9: 25,150,834 Y45H probably damaging Het
Icam5 A G 9: 21,038,749 Y868C probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Homo
Luzp1 C A 4: 136,541,266 Q267K probably benign Het
Nkpd1 C A 7: 19,524,603 A769E possibly damaging Het
Olfr482 AACTCTGTCACT AACT 7: 108,095,525 probably null Het
Pabpc4l C A 3: 46,446,703 V169L probably damaging Het
Pcdhga7 A G 18: 37,716,082 N381D probably damaging Het
Pcsk1 A T 13: 75,115,255 N372Y possibly damaging Het
Ppp1r21 C T 17: 88,569,185 T475M possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Psd2 G A 18: 36,006,723 probably null Het
Psip1 T C 4: 83,474,373 K100E probably benign Het
Pxdn A G 12: 30,003,112 H1096R probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc16a8 C T 15: 79,252,937 G91D probably damaging Het
Slc22a21 A T 11: 53,958,038 I296N probably damaging Het
Smad9 A G 3: 54,789,186 D224G probably benign Het
Tle2 G A 10: 81,588,872 V678M probably damaging Het
Tmc1 C T 19: 20,789,590 R749Q possibly damaging Het
Tmco3 T A 8: 13,292,077 probably null Het
Tspoap1 A G 11: 87,761,703 E101G possibly damaging Het
Zfp57 A T 17: 37,010,411 T386S probably benign Het
Other mutations in Gm4788
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Gm4788 APN 1 139731574 missense probably damaging 0.99
IGL01088:Gm4788 APN 1 139698085 utr 3 prime probably benign
IGL01419:Gm4788 APN 1 139739644 critical splice acceptor site probably null
IGL01552:Gm4788 APN 1 139739302 missense probably damaging 1.00
IGL01924:Gm4788 APN 1 139739206 missense probably damaging 0.99
IGL02032:Gm4788 APN 1 139774546 missense probably damaging 1.00
IGL02254:Gm4788 APN 1 139733405 splice site probably benign
IGL02318:Gm4788 APN 1 139781097 missense probably benign 0.20
IGL02527:Gm4788 APN 1 139753045 missense probably damaging 1.00
IGL02531:Gm4788 APN 1 139774569 missense probably benign 0.10
IGL02587:Gm4788 APN 1 139701930 missense probably damaging 1.00
IGL02644:Gm4788 APN 1 139781167 start codon destroyed probably null 0.63
IGL02852:Gm4788 APN 1 139774016 missense probably damaging 1.00
IGL02963:Gm4788 APN 1 139731596 nonsense probably null
IGL03084:Gm4788 APN 1 139781142 missense possibly damaging 0.94
R0131:Gm4788 UTSW 1 139754271 missense probably damaging 0.98
R0131:Gm4788 UTSW 1 139754271 missense probably damaging 0.98
R0132:Gm4788 UTSW 1 139754271 missense probably damaging 0.98
R0549:Gm4788 UTSW 1 139739488 missense probably damaging 1.00
R0558:Gm4788 UTSW 1 139739492 missense probably damaging 0.99
R0610:Gm4788 UTSW 1 139701846 missense probably benign 0.20
R1341:Gm4788 UTSW 1 139732393 missense probably damaging 0.98
R1460:Gm4788 UTSW 1 139698196 missense probably damaging 0.99
R1544:Gm4788 UTSW 1 139736870 missense probably damaging 1.00
R1873:Gm4788 UTSW 1 139774660 missense probably damaging 0.97
R2032:Gm4788 UTSW 1 139733255 splice site probably benign
R2111:Gm4788 UTSW 1 139774679 splice site probably benign
R2179:Gm4788 UTSW 1 139731541 missense probably damaging 1.00
R3806:Gm4788 UTSW 1 139753035 missense probably damaging 1.00
R4356:Gm4788 UTSW 1 139732310 missense probably damaging 1.00
R4747:Gm4788 UTSW 1 139698184 missense probably damaging 1.00
R4838:Gm4788 UTSW 1 139733443 missense probably damaging 1.00
R4867:Gm4788 UTSW 1 139774475 critical splice donor site probably null
R4910:Gm4788 UTSW 1 139774563 missense probably damaging 1.00
R4911:Gm4788 UTSW 1 139774563 missense probably damaging 1.00
R5050:Gm4788 UTSW 1 139736840 missense probably damaging 0.99
R5120:Gm4788 UTSW 1 139753103 missense probably benign 0.39
R5259:Gm4788 UTSW 1 139740495 missense probably damaging 1.00
R5504:Gm4788 UTSW 1 139701820 missense probably benign 0.18
R5825:Gm4788 UTSW 1 139774598 synonymous probably null
R5949:Gm4788 UTSW 1 139733149 missense probably damaging 0.98
R6140:Gm4788 UTSW 1 139732395 missense probably damaging 1.00
R6254:Gm4788 UTSW 1 139754390 missense probably damaging 0.98
R6255:Gm4788 UTSW 1 139753011 nonsense probably null
R6334:Gm4788 UTSW 1 139773924 unclassified probably null
R6611:Gm4788 UTSW 1 139732390 missense probably damaging 1.00
R6798:Gm4788 UTSW 1 139698121 missense probably benign 0.20
R6800:Gm4788 UTSW 1 139701981 missense possibly damaging 0.85
R6895:Gm4788 UTSW 1 139740472 missense possibly damaging 0.84
R6904:Gm4788 UTSW 1 139731653 missense possibly damaging 0.79
R6994:Gm4788 UTSW 1 139736930 missense possibly damaging 0.67
R7173:Gm4788 UTSW 1 139731677 nonsense probably null
R7184:Gm4788 UTSW 1 139733084 missense possibly damaging 0.65
R7192:Gm4788 UTSW 1 139739295 missense probably damaging 0.96
R7205:Gm4788 UTSW 1 139753050 nonsense probably null
R7308:Gm4788 UTSW 1 139754303 missense possibly damaging 0.71
X0009:Gm4788 UTSW 1 139733549 missense probably benign 0.08
X0024:Gm4788 UTSW 1 139733509 missense probably damaging 1.00
Z1088:Gm4788 UTSW 1 139754261 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTGCAGCTCTTCAAAGACTTC -3'
(R):5'- ACTTGAGTGTTCAGAATCTCAGATG -3'

Sequencing Primer
(F):5'- TGAACGGATATTCTACAATGCAGG -3'
(R):5'- GTGTTCAGAATCTCAGATGACTATG -3'
Posted On2018-02-27