Incidental Mutation 'R6200:Gm16432'
ID503132
Institutional Source Beutler Lab
Gene Symbol Gm16432
Ensembl Gene ENSMUSG00000091476
Gene Namepredicted gene 16432
SynonymsEG545391
MMRRC Submission 044340-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R6200 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location177983423-178172704 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 178111558 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 666 (N666D)
Ref Sequence ENSEMBL: ENSMUSP00000142187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000192146]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191719
Predicted Effect possibly damaging
Transcript: ENSMUST00000192146
AA Change: N666D

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142187
Gene: ENSMUSG00000091476
AA Change: N666D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:CATSPERD 207 774 1.7e-200 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 91% (32/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,090,050 Y54C probably damaging Het
Ash1l A G 3: 89,070,527 H2719R probably damaging Het
Atraid A G 5: 31,052,866 N127D probably damaging Het
Capzb T C 4: 139,280,013 V145A probably benign Het
Cldn17 A C 16: 88,506,571 L90R probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Fancc A C 13: 63,360,248 L158V probably damaging Het
Fcamr T C 1: 130,803,190 L60P probably benign Het
G6pd2 C T 5: 61,809,871 R330C probably benign Het
Gm4788 T A 1: 139,754,335 R174S probably damaging Het
Gpr158 A T 2: 21,399,416 N333I probably damaging Het
Herpud2 A G 9: 25,150,834 Y45H probably damaging Het
Icam5 A G 9: 21,038,749 Y868C probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Homo
Luzp1 C A 4: 136,541,266 Q267K probably benign Het
Nkpd1 C A 7: 19,524,603 A769E possibly damaging Het
Olfr482 AACTCTGTCACT AACT 7: 108,095,525 probably null Het
Pabpc4l C A 3: 46,446,703 V169L probably damaging Het
Pcdhga7 A G 18: 37,716,082 N381D probably damaging Het
Pcsk1 A T 13: 75,115,255 N372Y possibly damaging Het
Ppp1r21 C T 17: 88,569,185 T475M possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Psd2 G A 18: 36,006,723 probably null Het
Psip1 T C 4: 83,474,373 K100E probably benign Het
Pxdn A G 12: 30,003,112 H1096R probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc16a8 C T 15: 79,252,937 G91D probably damaging Het
Slc22a21 A T 11: 53,958,038 I296N probably damaging Het
Smad9 A G 3: 54,789,186 D224G probably benign Het
Tle2 G A 10: 81,588,872 V678M probably damaging Het
Tmc1 C T 19: 20,789,590 R749Q possibly damaging Het
Tmco3 T A 8: 13,292,077 probably null Het
Tspoap1 A G 11: 87,761,703 E101G possibly damaging Het
Zfp57 A T 17: 37,010,411 T386S probably benign Het
Other mutations in Gm16432
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01925:Gm16432 APN 1 178015121 splice site probably benign
IGL02345:Gm16432 APN 1 178015188 missense possibly damaging 0.46
R0089:Gm16432 UTSW 1 178046989 missense unknown
R0103:Gm16432 UTSW 1 178116205 missense unknown
R1491:Gm16432 UTSW 1 178015929 missense possibly damaging 0.92
R1662:Gm16432 UTSW 1 178046986 missense unknown
R1840:Gm16432 UTSW 1 178003015 missense possibly damaging 0.90
R2168:Gm16432 UTSW 1 178015911 splice site probably benign
R3764:Gm16432 UTSW 1 178113132 missense unknown
R4586:Gm16432 UTSW 1 178122785 missense possibly damaging 0.90
R4887:Gm16432 UTSW 1 178103949 missense unknown
R4990:Gm16432 UTSW 1 178098421 missense probably benign 0.14
R4991:Gm16432 UTSW 1 178098421 missense probably benign 0.14
R5225:Gm16432 UTSW 1 178148908 utr 3 prime probably benign
R5285:Gm16432 UTSW 1 178103888 missense unknown
R5569:Gm16432 UTSW 1 178111596 missense possibly damaging 0.82
R5743:Gm16432 UTSW 1 178122762 splice site silent
R5756:Gm16432 UTSW 1 178116227 missense unknown
R6050:Gm16432 UTSW 1 178103924 missense unknown
R6166:Gm16432 UTSW 1 178103837 missense unknown
R6322:Gm16432 UTSW 1 178017730 nonsense probably null
R6438:Gm16432 UTSW 1 178111303 missense possibly damaging 0.92
R6736:Gm16432 UTSW 1 178017712 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGATTTAGGAGACTGGTGCCC -3'
(R):5'- TACTTCCTAACAGGTGTGCAG -3'

Sequencing Primer
(F):5'- TAGGAGACTGGTGCCCATATC -3'
(R):5'- TTCCTAACAGGTGTGCAGAGTCC -3'
Posted On2018-02-27