Incidental Mutation 'R6200:Prpf40a'
ID503134
Institutional Source Beutler Lab
Gene Symbol Prpf40a
Ensembl Gene ENSMUSG00000061136
Gene Namepre-mRNA processing factor 40A
SynonymsFnbp3, FBP11, 2810012K09Rik
MMRRC Submission 044340-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.829) question?
Stock #R6200 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location53134704-53191284 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53157915 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 197 (M197V)
Ref Sequence ENSEMBL: ENSMUSP00000147599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076313] [ENSMUST00000125243] [ENSMUST00000209364] [ENSMUST00000209508] [ENSMUST00000210789] [ENSMUST00000211102] [ENSMUST00000211712]
Predicted Effect probably benign
Transcript: ENSMUST00000076313
AA Change: M239V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075655
Gene: ENSMUSG00000061136
AA Change: M239V

DomainStartEndE-ValueType
low complexity region 77 124 N/A INTRINSIC
WW 141 173 7.54e-13 SMART
WW 182 214 1.57e-10 SMART
low complexity region 272 294 N/A INTRINSIC
FF 389 443 1.32e-17 SMART
FF 456 515 4.22e1 SMART
FF 523 583 1.11e-10 SMART
FF 603 663 4.31e0 SMART
low complexity region 670 682 N/A INTRINSIC
FF 739 795 7.43e-12 SMART
low complexity region 802 879 N/A INTRINSIC
low complexity region 883 923 N/A INTRINSIC
low complexity region 929 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125243
SMART Domains Protein: ENSMUSP00000117406
Gene: ENSMUSG00000061136

DomainStartEndE-ValueType
low complexity region 35 82 N/A INTRINSIC
WW 99 131 7.54e-13 SMART
WW 140 172 1.57e-10 SMART
low complexity region 230 252 N/A INTRINSIC
FF 347 401 1.32e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209364
AA Change: M212V

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000209508
Predicted Effect probably benign
Transcript: ENSMUST00000210789
AA Change: M197V

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000211102
Predicted Effect probably benign
Transcript: ENSMUST00000211712
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 91% (32/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,090,050 Y54C probably damaging Het
Ash1l A G 3: 89,070,527 H2719R probably damaging Het
Atraid A G 5: 31,052,866 N127D probably damaging Het
Capzb T C 4: 139,280,013 V145A probably benign Het
Cldn17 A C 16: 88,506,571 L90R probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Fancc A C 13: 63,360,248 L158V probably damaging Het
Fcamr T C 1: 130,803,190 L60P probably benign Het
G6pd2 C T 5: 61,809,871 R330C probably benign Het
Gm16432 A G 1: 178,111,558 N666D possibly damaging Het
Gm4788 T A 1: 139,754,335 R174S probably damaging Het
Gpr158 A T 2: 21,399,416 N333I probably damaging Het
Herpud2 A G 9: 25,150,834 Y45H probably damaging Het
Icam5 A G 9: 21,038,749 Y868C probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Homo
Luzp1 C A 4: 136,541,266 Q267K probably benign Het
Nkpd1 C A 7: 19,524,603 A769E possibly damaging Het
Olfr482 AACTCTGTCACT AACT 7: 108,095,525 probably null Het
Pabpc4l C A 3: 46,446,703 V169L probably damaging Het
Pcdhga7 A G 18: 37,716,082 N381D probably damaging Het
Pcsk1 A T 13: 75,115,255 N372Y possibly damaging Het
Ppp1r21 C T 17: 88,569,185 T475M possibly damaging Het
Psd2 G A 18: 36,006,723 probably null Het
Psip1 T C 4: 83,474,373 K100E probably benign Het
Pxdn A G 12: 30,003,112 H1096R probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc16a8 C T 15: 79,252,937 G91D probably damaging Het
Slc22a21 A T 11: 53,958,038 I296N probably damaging Het
Smad9 A G 3: 54,789,186 D224G probably benign Het
Tle2 G A 10: 81,588,872 V678M probably damaging Het
Tmc1 C T 19: 20,789,590 R749Q possibly damaging Het
Tmco3 T A 8: 13,292,077 probably null Het
Tspoap1 A G 11: 87,761,703 E101G possibly damaging Het
Zfp57 A T 17: 37,010,411 T386S probably benign Het
Other mutations in Prpf40a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Prpf40a APN 2 53150688 missense probably benign 0.00
IGL00533:Prpf40a APN 2 53145343 missense probably damaging 1.00
IGL01099:Prpf40a APN 2 53141835 missense probably benign 0.00
IGL02039:Prpf40a APN 2 53144803 missense probably damaging 1.00
IGL02608:Prpf40a APN 2 53146153 missense probably damaging 0.97
I1329:Prpf40a UTSW 2 53176395 missense probably benign 0.01
R0284:Prpf40a UTSW 2 53150647 missense probably damaging 1.00
R0401:Prpf40a UTSW 2 53159313 missense probably damaging 0.99
R0544:Prpf40a UTSW 2 53141651 unclassified probably benign
R0582:Prpf40a UTSW 2 53145692 missense probably damaging 1.00
R1533:Prpf40a UTSW 2 53145840 missense probably damaging 1.00
R2057:Prpf40a UTSW 2 53144839 missense probably damaging 1.00
R4274:Prpf40a UTSW 2 53146172 missense probably damaging 1.00
R4604:Prpf40a UTSW 2 53142023 missense probably damaging 0.99
R4814:Prpf40a UTSW 2 53190020 missense probably damaging 1.00
R4976:Prpf40a UTSW 2 53144849 missense probably damaging 1.00
R5119:Prpf40a UTSW 2 53144849 missense probably damaging 1.00
R5378:Prpf40a UTSW 2 53145876 missense probably damaging 1.00
R5448:Prpf40a UTSW 2 53156926 missense possibly damaging 0.63
R5449:Prpf40a UTSW 2 53156926 missense possibly damaging 0.63
R5450:Prpf40a UTSW 2 53156926 missense possibly damaging 0.63
R5500:Prpf40a UTSW 2 53145284 missense probably benign 0.03
R5637:Prpf40a UTSW 2 53156734 missense possibly damaging 0.59
R6052:Prpf40a UTSW 2 53159281 missense probably benign 0.41
R6149:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6150:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6151:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6162:Prpf40a UTSW 2 53159305 missense probably benign 0.01
R6199:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6207:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6254:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6266:Prpf40a UTSW 2 53156627 missense probably benign 0.17
R6394:Prpf40a UTSW 2 53144878 missense probably damaging 1.00
R6603:Prpf40a UTSW 2 53152963 missense probably damaging 0.96
R6606:Prpf40a UTSW 2 53151751 missense probably damaging 0.99
R6641:Prpf40a UTSW 2 53141626 unclassified probably benign
R6929:Prpf40a UTSW 2 53144863 missense possibly damaging 0.95
R7158:Prpf40a UTSW 2 53152553 missense probably damaging 0.99
X0060:Prpf40a UTSW 2 53145664 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTCGTAAGGCTCAGGAAGTC -3'
(R):5'- TTGCATTGAGGCTTTGAAACTC -3'

Sequencing Primer
(F):5'- CAACATACGCAAGGCTGTGGTTC -3'
(R):5'- TGAGGCTTTGAAACTCAAGTAAATAC -3'
Posted On2018-02-27