Incidental Mutation 'R6200:Capzb'
ID503141
Institutional Source Beutler Lab
Gene Symbol Capzb
Ensembl Gene ENSMUSG00000028745
Gene Namecapping protein (actin filament) muscle Z-line, beta
Synonyms1700120C01Rik, CPB2, Cappb1, CPbeta1, CPbeta2, CPB1
MMRRC Submission 044340-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.915) question?
Stock #R6200 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location139192899-139291818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139280013 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 145 (V145A)
Ref Sequence ENSEMBL: ENSMUSP00000030518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030518] [ENSMUST00000042675] [ENSMUST00000102507] [ENSMUST00000102508] [ENSMUST00000131912] [ENSMUST00000138045]
Predicted Effect probably benign
Transcript: ENSMUST00000030518
AA Change: V145A

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030518
Gene: ENSMUSG00000028745
AA Change: V145A

DomainStartEndE-ValueType
Pfam:F_actin_cap_B 35 269 6.2e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042675
AA Change: V104A

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000038011
Gene: ENSMUSG00000028745
AA Change: V104A

DomainStartEndE-ValueType
Pfam:F_actin_cap_B 1 228 4.7e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102507
AA Change: V116A

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099565
Gene: ENSMUSG00000028745
AA Change: V116A

DomainStartEndE-ValueType
Pfam:F_actin_cap_B 6 240 4.6e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102508
AA Change: V116A

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099566
Gene: ENSMUSG00000028745
AA Change: V116A

DomainStartEndE-ValueType
Pfam:F_actin_cap_B 5 240 6.8e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131912
AA Change: V164A

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114973
Gene: ENSMUSG00000028745
AA Change: V164A

DomainStartEndE-ValueType
Pfam:F_actin_cap_B 5 113 1.5e-53 PFAM
low complexity region 115 126 N/A INTRINSIC
Pfam:F_actin_cap_B 143 188 4.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138045
AA Change: V104A

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000122077
Gene: ENSMUSG00000028745
AA Change: V104A

DomainStartEndE-ValueType
Pfam:F_actin_cap_B 1 204 9.8e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150077
Meta Mutation Damage Score 0.302 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 91% (32/35)
MGI Phenotype FUNCTION: This gene encodes the beta subunit of a highly conserved filamentous actin capping protein that binds the barbed end of filamentous actin to stabilize it and terminate elongation. Interaction of this protein with the barbed end of the actin filament occurs through binding of the amphipathic helix at the C-terminus to the hydrophobic cleft on the actin molecule. This gene is required for a variety of dynamic actin-mediated processes including organization of lamellipodia and filopodia, growth cone morphology and neurite outgrowth in hippocampal neurons, and asymmetric spindle migration and polar body extrusion during oocyte maturation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in the ear exhibit increased ABR threshold, absent DPOE, reduced vestibular function, head shaking and abnormal stereocilia length and width in the cochlea and utricle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,090,050 Y54C probably damaging Het
Ash1l A G 3: 89,070,527 H2719R probably damaging Het
Atraid A G 5: 31,052,866 N127D probably damaging Het
Cldn17 A C 16: 88,506,571 L90R probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Fancc A C 13: 63,360,248 L158V probably damaging Het
Fcamr T C 1: 130,803,190 L60P probably benign Het
G6pd2 C T 5: 61,809,871 R330C probably benign Het
Gm16432 A G 1: 178,111,558 N666D possibly damaging Het
Gm4788 T A 1: 139,754,335 R174S probably damaging Het
Gpr158 A T 2: 21,399,416 N333I probably damaging Het
Herpud2 A G 9: 25,150,834 Y45H probably damaging Het
Icam5 A G 9: 21,038,749 Y868C probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Homo
Luzp1 C A 4: 136,541,266 Q267K probably benign Het
Nkpd1 C A 7: 19,524,603 A769E possibly damaging Het
Olfr482 AACTCTGTCACT AACT 7: 108,095,525 probably null Het
Pabpc4l C A 3: 46,446,703 V169L probably damaging Het
Pcdhga7 A G 18: 37,716,082 N381D probably damaging Het
Pcsk1 A T 13: 75,115,255 N372Y possibly damaging Het
Ppp1r21 C T 17: 88,569,185 T475M possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Psd2 G A 18: 36,006,723 probably null Het
Psip1 T C 4: 83,474,373 K100E probably benign Het
Pxdn A G 12: 30,003,112 H1096R probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc16a8 C T 15: 79,252,937 G91D probably damaging Het
Slc22a21 A T 11: 53,958,038 I296N probably damaging Het
Smad9 A G 3: 54,789,186 D224G probably benign Het
Tle2 G A 10: 81,588,872 V678M probably damaging Het
Tmc1 C T 19: 20,789,590 R749Q possibly damaging Het
Tmco3 T A 8: 13,292,077 probably null Het
Tspoap1 A G 11: 87,761,703 E101G possibly damaging Het
Zfp57 A T 17: 37,010,411 T386S probably benign Het
Other mutations in Capzb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Capzb APN 4 139288947 missense probably benign 0.00
IGL00885:Capzb APN 4 139287050 missense probably benign 0.00
R0612:Capzb UTSW 4 139291029 missense probably benign
R0729:Capzb UTSW 4 139288977 unclassified probably benign
R1547:Capzb UTSW 4 139262098 unclassified probably null
R1731:Capzb UTSW 4 139280030 missense probably damaging 1.00
R1748:Capzb UTSW 4 139257368 missense probably damaging 1.00
R2234:Capzb UTSW 4 139262023 missense possibly damaging 0.80
R2424:Capzb UTSW 4 139194130 start codon destroyed probably null 0.01
R4799:Capzb UTSW 4 139192999 utr 5 prime probably benign
R5076:Capzb UTSW 4 139287814 missense possibly damaging 0.85
R5596:Capzb UTSW 4 139279427 intron probably benign
X0012:Capzb UTSW 4 139257291 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GGTTAAAATGTCATCCCTGGGTTC -3'
(R):5'- AGCATGTCCCTTGCAGAAGC -3'

Sequencing Primer
(F):5'- AAAATGTCATCCCTGGGTTCTTGTG -3'
(R):5'- AAGAGCTGCACTGACGGTTC -3'
Posted On2018-02-27