Incidental Mutation 'R6200:Atraid'
ID503142
Institutional Source Beutler Lab
Gene Symbol Atraid
Ensembl Gene ENSMUSG00000013622
Gene Nameall-trans retinoic acid induced differentiation factor
SynonymsHSPC013, 0610007C21Rik, p18
MMRRC Submission 044340-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R6200 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location31048312-31054623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31052866 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 127 (N127D)
Ref Sequence ENSEMBL: ENSMUSP00000144333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013766] [ENSMUST00000013773] [ENSMUST00000080431] [ENSMUST00000114668] [ENSMUST00000200816] [ENSMUST00000200942] [ENSMUST00000200953] [ENSMUST00000201136] [ENSMUST00000201174] [ENSMUST00000201182] [ENSMUST00000201773] [ENSMUST00000201838] [ENSMUST00000202520] [ENSMUST00000202556] [ENSMUST00000202795]
Predicted Effect probably damaging
Transcript: ENSMUST00000013766
AA Change: N151D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000013766
Gene: ENSMUSG00000013622
AA Change: N151D

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 149 187 2.03e1 SMART
transmembrane domain 192 214 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000013773
SMART Domains Protein: ENSMUSP00000013773
Gene: ENSMUSG00000013629

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.7e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 1.2e-15 PFAM
Pfam:CPSase_L_D2 514 718 1.8e-85 PFAM
Pfam:ATP-grasp 522 690 1.5e-9 PFAM
Pfam:Dala_Dala_lig_C 527 687 2.2e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 1.8e-23 PFAM
Pfam:CPSase_L_D2 1047 1250 3.1e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 2.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 2.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 7.4e-12 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1924 2065 1.9e-44 PFAM
Pfam:OTCace 2071 2221 7.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080431
SMART Domains Protein: ENSMUSP00000079291
Gene: ENSMUSG00000006641

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:SSF 58 462 7.9e-41 PFAM
low complexity region 496 506 N/A INTRINSIC
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 562 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114668
SMART Domains Protein: ENSMUSP00000110316
Gene: ENSMUSG00000006641

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:SSF 58 462 7.9e-41 PFAM
low complexity region 496 506 N/A INTRINSIC
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 562 573 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000200748
AA Change: N134D
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200800
Predicted Effect probably benign
Transcript: ENSMUST00000200816
SMART Domains Protein: ENSMUSP00000144665
Gene: ENSMUSG00000006641

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200942
Predicted Effect probably benign
Transcript: ENSMUST00000200953
SMART Domains Protein: ENSMUSP00000144307
Gene: ENSMUSG00000013629

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.5e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:CPSase_L_D2 514 616 1.5e-34 PFAM
Pfam:Dala_Dala_lig_C 527 625 2.4e-7 PFAM
Pfam:CPSase_L_D2 614 655 4.9e-15 PFAM
CPSase_L_D3 735 858 9.7e-59 SMART
Pfam:ATP-grasp_4 981 1160 1.7e-23 PFAM
Pfam:CPSase_L_D2 984 1187 3e-28 PFAM
Pfam:Dala_Dala_lig_C 991 1179 2.3e-7 PFAM
Pfam:ATP-grasp 992 1159 2.1e-12 PFAM
MGS 1264 1365 1.35e-7 SMART
Pfam:Amidohydro_1 1399 1667 7.1e-12 PFAM
low complexity region 1757 1776 N/A INTRINSIC
low complexity region 1801 1817 N/A INTRINSIC
Pfam:OTCace_N 1861 2002 1.8e-44 PFAM
Pfam:OTCace 2008 2158 7.3e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201136
AA Change: N98D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144085
Gene: ENSMUSG00000013622
AA Change: N98D

DomainStartEndE-ValueType
EGF 96 134 2.03e1 SMART
transmembrane domain 138 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201174
Predicted Effect probably benign
Transcript: ENSMUST00000201182
SMART Domains Protein: ENSMUSP00000144684
Gene: ENSMUSG00000013629

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.5e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 1.1e-15 PFAM
Pfam:CPSase_L_D2 514 718 1.7e-85 PFAM
Pfam:ATP-grasp 522 690 1.4e-9 PFAM
Pfam:Dala_Dala_lig_C 527 687 2.1e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 1.7e-23 PFAM
Pfam:CPSase_L_D2 1047 1250 3e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 2.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 2.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 7.1e-12 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1949 1994 1.4e-11 PFAM
Pfam:OTCace 2000 2150 7.3e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201773
AA Change: N127D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144333
Gene: ENSMUSG00000013622
AA Change: N127D

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201838
SMART Domains Protein: ENSMUSP00000144127
Gene: ENSMUSG00000013629

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 6.3e-48 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 1.9e-16 PFAM
Pfam:CPSase_L_D2 514 718 3.7e-86 PFAM
Pfam:ATP-grasp 522 690 2.5e-10 PFAM
Pfam:Dala_Dala_lig_C 526 687 4.2e-11 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
SCOP:d1a9xa3 935 964 1e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201887
Predicted Effect probably benign
Transcript: ENSMUST00000202520
SMART Domains Protein: ENSMUSP00000143938
Gene: ENSMUSG00000006641

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:SSF 58 462 7.9e-41 PFAM
low complexity region 496 506 N/A INTRINSIC
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 562 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202556
SMART Domains Protein: ENSMUSP00000143993
Gene: ENSMUSG00000006641

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:SSF 58 462 7.9e-41 PFAM
low complexity region 496 506 N/A INTRINSIC
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 562 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202795
SMART Domains Protein: ENSMUSP00000144009
Gene: ENSMUSG00000013629

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 1.9e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 5.9e-16 PFAM
Pfam:CPSase_L_D2 514 718 1.2e-85 PFAM
Pfam:ATP-grasp 522 690 7.3e-10 PFAM
Pfam:Dala_Dala_lig_C 527 687 1.3e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 8.9e-24 PFAM
Pfam:CPSase_L_D2 1047 1250 2.1e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 1.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 1.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 2.5e-11 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1970 2004 4.6e-11 PFAM
Pfam:OTCace 2010 2160 9.9e-37 PFAM
Meta Mutation Damage Score 0.204 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 91% (32/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to be involved in apoptosis, and may also be involved in hematopoietic development and differentiation. The use of alternative splice sites and promotors result in multiple transcript variants encoding different isoforms.[provided by RefSeq, Dec 2009]
PHENOTYPE: Mice heterozygous or homozygous for a gene trap mutation exhibit cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,090,050 Y54C probably damaging Het
Ash1l A G 3: 89,070,527 H2719R probably damaging Het
Capzb T C 4: 139,280,013 V145A probably benign Het
Cldn17 A C 16: 88,506,571 L90R probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Fancc A C 13: 63,360,248 L158V probably damaging Het
Fcamr T C 1: 130,803,190 L60P probably benign Het
G6pd2 C T 5: 61,809,871 R330C probably benign Het
Gm16432 A G 1: 178,111,558 N666D possibly damaging Het
Gm4788 T A 1: 139,754,335 R174S probably damaging Het
Gpr158 A T 2: 21,399,416 N333I probably damaging Het
Herpud2 A G 9: 25,150,834 Y45H probably damaging Het
Icam5 A G 9: 21,038,749 Y868C probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Homo
Luzp1 C A 4: 136,541,266 Q267K probably benign Het
Nkpd1 C A 7: 19,524,603 A769E possibly damaging Het
Olfr482 AACTCTGTCACT AACT 7: 108,095,525 probably null Het
Pabpc4l C A 3: 46,446,703 V169L probably damaging Het
Pcdhga7 A G 18: 37,716,082 N381D probably damaging Het
Pcsk1 A T 13: 75,115,255 N372Y possibly damaging Het
Ppp1r21 C T 17: 88,569,185 T475M possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Psd2 G A 18: 36,006,723 probably null Het
Psip1 T C 4: 83,474,373 K100E probably benign Het
Pxdn A G 12: 30,003,112 H1096R probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc16a8 C T 15: 79,252,937 G91D probably damaging Het
Slc22a21 A T 11: 53,958,038 I296N probably damaging Het
Smad9 A G 3: 54,789,186 D224G probably benign Het
Tle2 G A 10: 81,588,872 V678M probably damaging Het
Tmc1 C T 19: 20,789,590 R749Q possibly damaging Het
Tmco3 T A 8: 13,292,077 probably null Het
Tspoap1 A G 11: 87,761,703 E101G possibly damaging Het
Zfp57 A T 17: 37,010,411 T386S probably benign Het
Other mutations in Atraid
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02689:Atraid APN 5 31052482 missense probably damaging 1.00
IGL02794:Atraid APN 5 31052870 missense probably damaging 1.00
R0528:Atraid UTSW 5 31052452 unclassified probably benign
R0682:Atraid UTSW 5 31052268 missense probably damaging 1.00
R4085:Atraid UTSW 5 31052306 unclassified probably benign
R5213:Atraid UTSW 5 31052208 missense probably damaging 1.00
R7214:Atraid UTSW 5 31052246 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTTTGTTCTACTCCCGAGC -3'
(R):5'- ATTTGTACATCAAAAGTAGAGGGAAA -3'

Sequencing Primer
(F):5'- GAGCTACACCCCAACCTCTTTG -3'
(R):5'- CCAACTCAGATTGCAGAGTGAGTTC -3'
Posted On2018-02-27