Incidental Mutation 'R6200:G6pd2'
ID503143
Institutional Source Beutler Lab
Gene Symbol G6pd2
Ensembl Gene ENSMUSG00000089992
Gene Nameglucose-6-phosphate dehydrogenase 2
SynonymsGpd2, Gpd-2, G6pdx-ps1
MMRRC Submission 044340-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.540) question?
Stock #R6200 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location61808816-61811163 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61809871 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 330 (R330C)
Ref Sequence ENSEMBL: ENSMUSP00000131163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053876]
Predicted Effect probably benign
Transcript: ENSMUST00000053876
AA Change: R330C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000131163
Gene: ENSMUSG00000089992
AA Change: R330C

DomainStartEndE-ValueType
Pfam:G6PD_N 35 210 4.1e-60 PFAM
Pfam:G6PD_C 212 504 9.9e-119 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 91% (32/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,090,050 Y54C probably damaging Het
Ash1l A G 3: 89,070,527 H2719R probably damaging Het
Atraid A G 5: 31,052,866 N127D probably damaging Het
Capzb T C 4: 139,280,013 V145A probably benign Het
Cldn17 A C 16: 88,506,571 L90R probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Fancc A C 13: 63,360,248 L158V probably damaging Het
Fcamr T C 1: 130,803,190 L60P probably benign Het
Gm16432 A G 1: 178,111,558 N666D possibly damaging Het
Gm4788 T A 1: 139,754,335 R174S probably damaging Het
Gpr158 A T 2: 21,399,416 N333I probably damaging Het
Herpud2 A G 9: 25,150,834 Y45H probably damaging Het
Icam5 A G 9: 21,038,749 Y868C probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Homo
Luzp1 C A 4: 136,541,266 Q267K probably benign Het
Nkpd1 C A 7: 19,524,603 A769E possibly damaging Het
Olfr482 AACTCTGTCACT AACT 7: 108,095,525 probably null Het
Pabpc4l C A 3: 46,446,703 V169L probably damaging Het
Pcdhga7 A G 18: 37,716,082 N381D probably damaging Het
Pcsk1 A T 13: 75,115,255 N372Y possibly damaging Het
Ppp1r21 C T 17: 88,569,185 T475M possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Psd2 G A 18: 36,006,723 probably null Het
Psip1 T C 4: 83,474,373 K100E probably benign Het
Pxdn A G 12: 30,003,112 H1096R probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc16a8 C T 15: 79,252,937 G91D probably damaging Het
Slc22a21 A T 11: 53,958,038 I296N probably damaging Het
Smad9 A G 3: 54,789,186 D224G probably benign Het
Tle2 G A 10: 81,588,872 V678M probably damaging Het
Tmc1 C T 19: 20,789,590 R749Q possibly damaging Het
Tmco3 T A 8: 13,292,077 probably null Het
Tspoap1 A G 11: 87,761,703 E101G possibly damaging Het
Zfp57 A T 17: 37,010,411 T386S probably benign Het
Other mutations in G6pd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:G6pd2 APN 5 61810063 missense probably benign
IGL01329:G6pd2 APN 5 61809938 missense probably damaging 1.00
IGL02072:G6pd2 APN 5 61809410 missense probably damaging 1.00
IGL02502:G6pd2 APN 5 61809628 missense probably damaging 1.00
IGL02800:G6pd2 APN 5 61809392 missense probably damaging 1.00
IGL03012:G6pd2 APN 5 61809473 missense probably damaging 1.00
IGL03085:G6pd2 APN 5 61810302 missense probably benign
R0505:G6pd2 UTSW 5 61809567 missense probably benign
R0632:G6pd2 UTSW 5 61810171 missense probably benign
R0658:G6pd2 UTSW 5 61809674 missense probably damaging 1.00
R1399:G6pd2 UTSW 5 61810018 missense probably benign 0.02
R1918:G6pd2 UTSW 5 61810321 missense probably benign
R2077:G6pd2 UTSW 5 61810251 missense probably damaging 0.97
R2338:G6pd2 UTSW 5 61810008 missense probably benign
R2566:G6pd2 UTSW 5 61808987 missense probably damaging 1.00
R2918:G6pd2 UTSW 5 61809526 missense probably damaging 1.00
R3963:G6pd2 UTSW 5 61808885 start codon destroyed probably null 0.50
R4399:G6pd2 UTSW 5 61810173 missense probably benign 0.01
R4469:G6pd2 UTSW 5 61808945 missense probably benign
R4560:G6pd2 UTSW 5 61810343 missense possibly damaging 0.95
R4563:G6pd2 UTSW 5 61810343 missense possibly damaging 0.95
R4914:G6pd2 UTSW 5 61810329 nonsense probably null
R5106:G6pd2 UTSW 5 61810352 missense probably benign
R5242:G6pd2 UTSW 5 61809442 missense probably benign 0.00
R5838:G6pd2 UTSW 5 61809225 missense probably benign
R6131:G6pd2 UTSW 5 61809250 missense probably benign 0.03
R7009:G6pd2 UTSW 5 61808891 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GATGTTATGCAGAGCCACCTCC -3'
(R):5'- CCAGCTCATTACGCTTGCAC -3'

Sequencing Primer
(F):5'- AGCCACCTCCTGCAGATGTTG -3'
(R):5'- CATTACGCTTGCACTTCTGGTGG -3'
Posted On2018-02-27