Incidental Mutation 'R6200:Tmco3'
ID503147
Institutional Source Beutler Lab
Gene Symbol Tmco3
Ensembl Gene ENSMUSG00000038497
Gene Nametransmembrane and coiled-coil domains 3
SynonymsB230339H12Rik
MMRRC Submission 044340-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6200 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location13288190-13322924 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 13292077 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045229] [ENSMUST00000045366] [ENSMUST00000110838] [ENSMUST00000110839] [ENSMUST00000110840] [ENSMUST00000203467] [ENSMUST00000203604]
Predicted Effect probably damaging
Transcript: ENSMUST00000045229
AA Change: L117Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040347
Gene: ENSMUSG00000038497
AA Change: L117Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
coiled coil region 124 204 N/A INTRINSIC
Pfam:Na_H_Exchanger 274 662 9.2e-74 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000045366
SMART Domains Protein: ENSMUSP00000047208
Gene: ENSMUSG00000038506

DomainStartEndE-ValueType
Pfam:UBA_4 9 51 1.5e-13 PFAM
Pfam:Cullin_binding 136 247 2.2e-39 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110838
SMART Domains Protein: ENSMUSP00000106462
Gene: ENSMUSG00000038506

DomainStartEndE-ValueType
Pfam:UBA_4 9 50 9.9e-14 PFAM
PDB:4GAO|G 62 173 3e-71 PDB
Predicted Effect probably null
Transcript: ENSMUST00000110839
SMART Domains Protein: ENSMUSP00000106463
Gene: ENSMUSG00000038506

DomainStartEndE-ValueType
Pfam:UBA_4 9 50 1.1e-13 PFAM
Pfam:Cullin_binding 134 206 2.3e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110840
SMART Domains Protein: ENSMUSP00000106464
Gene: ENSMUSG00000038506

DomainStartEndE-ValueType
Pfam:UBA_4 9 50 7.6e-14 PFAM
PDB:4GAO|G 62 199 6e-75 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000203467
SMART Domains Protein: ENSMUSP00000145399
Gene: ENSMUSG00000038506

DomainStartEndE-ValueType
Pfam:UBA_4 9 51 7.5e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203604
SMART Domains Protein: ENSMUSP00000145430
Gene: ENSMUSG00000038506

DomainStartEndE-ValueType
Pfam:UBA_4 9 51 4.7e-11 PFAM
Pfam:Cullin_binding 136 213 1.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210063
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211645
Meta Mutation Damage Score 0.188 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 91% (32/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,090,050 Y54C probably damaging Het
Ash1l A G 3: 89,070,527 H2719R probably damaging Het
Atraid A G 5: 31,052,866 N127D probably damaging Het
Capzb T C 4: 139,280,013 V145A probably benign Het
Cldn17 A C 16: 88,506,571 L90R probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Fancc A C 13: 63,360,248 L158V probably damaging Het
Fcamr T C 1: 130,803,190 L60P probably benign Het
G6pd2 C T 5: 61,809,871 R330C probably benign Het
Gm16432 A G 1: 178,111,558 N666D possibly damaging Het
Gm4788 T A 1: 139,754,335 R174S probably damaging Het
Gpr158 A T 2: 21,399,416 N333I probably damaging Het
Herpud2 A G 9: 25,150,834 Y45H probably damaging Het
Icam5 A G 9: 21,038,749 Y868C probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Homo
Luzp1 C A 4: 136,541,266 Q267K probably benign Het
Nkpd1 C A 7: 19,524,603 A769E possibly damaging Het
Olfr482 AACTCTGTCACT AACT 7: 108,095,525 probably null Het
Pabpc4l C A 3: 46,446,703 V169L probably damaging Het
Pcdhga7 A G 18: 37,716,082 N381D probably damaging Het
Pcsk1 A T 13: 75,115,255 N372Y possibly damaging Het
Ppp1r21 C T 17: 88,569,185 T475M possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Psd2 G A 18: 36,006,723 probably null Het
Psip1 T C 4: 83,474,373 K100E probably benign Het
Pxdn A G 12: 30,003,112 H1096R probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc16a8 C T 15: 79,252,937 G91D probably damaging Het
Slc22a21 A T 11: 53,958,038 I296N probably damaging Het
Smad9 A G 3: 54,789,186 D224G probably benign Het
Tle2 G A 10: 81,588,872 V678M probably damaging Het
Tmc1 C T 19: 20,789,590 R749Q possibly damaging Het
Tspoap1 A G 11: 87,761,703 E101G possibly damaging Het
Zfp57 A T 17: 37,010,411 T386S probably benign Het
Other mutations in Tmco3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00824:Tmco3 APN 8 13292825 missense probably damaging 1.00
IGL01139:Tmco3 APN 8 13319887 missense possibly damaging 0.92
IGL02116:Tmco3 APN 8 13292706 unclassified probably benign
IGL03114:Tmco3 APN 8 13298205 splice site probably benign
Ganado UTSW 8 13292077 unclassified probably null
R0244:Tmco3 UTSW 8 13292037 missense probably damaging 1.00
R0385:Tmco3 UTSW 8 13296027 missense probably damaging 1.00
R0711:Tmco3 UTSW 8 13292039 missense probably damaging 0.96
R1594:Tmco3 UTSW 8 13292052 missense probably damaging 0.98
R1727:Tmco3 UTSW 8 13318866 missense possibly damaging 0.52
R1752:Tmco3 UTSW 8 13291741 missense probably benign
R2375:Tmco3 UTSW 8 13292059 missense possibly damaging 0.72
R2850:Tmco3 UTSW 8 13295024 missense probably benign 0.00
R3843:Tmco3 UTSW 8 13296114 splice site probably benign
R4003:Tmco3 UTSW 8 13291959 missense probably damaging 0.96
R4059:Tmco3 UTSW 8 13320848 missense probably benign 0.27
R5071:Tmco3 UTSW 8 13292860 nonsense probably null
R5072:Tmco3 UTSW 8 13292860 nonsense probably null
R5456:Tmco3 UTSW 8 13319815 missense probably damaging 0.96
R5556:Tmco3 UTSW 8 13294870 missense probably damaging 0.99
R5826:Tmco3 UTSW 8 13310314 missense probably damaging 0.99
R6586:Tmco3 UTSW 8 13320894 utr 3 prime probably benign
R6858:Tmco3 UTSW 8 13313924 missense probably damaging 1.00
R6867:Tmco3 UTSW 8 13313927 missense probably damaging 1.00
R6944:Tmco3 UTSW 8 13303729 missense probably damaging 1.00
R7082:Tmco3 UTSW 8 13320847 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTCCTGAGGCAGAAGAATG -3'
(R):5'- CACCTCCTAGACGCAATGAG -3'

Sequencing Primer
(F):5'- TGTGGTCCTCAACAAACTGAAG -3'
(R):5'- TCCTAGACGCAATGAGGGCAC -3'
Posted On2018-02-27