Incidental Mutation 'R6200:Fancc'
ID503155
Institutional Source Beutler Lab
Gene Symbol Fancc
Ensembl Gene ENSMUSG00000021461
Gene NameFanconi anemia, complementation group C
SynonymsFacc
MMRRC Submission 044340-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.808) question?
Stock #R6200 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location63285043-63497278 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 63360248 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 158 (L158V)
Ref Sequence ENSEMBL: ENSMUSP00000152119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073029] [ENSMUST00000099444] [ENSMUST00000159024] [ENSMUST00000161977] [ENSMUST00000162375] [ENSMUST00000162971] [ENSMUST00000163091] [ENSMUST00000220684]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073029
AA Change: L158V

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000072788
Gene: ENSMUSG00000021461
AA Change: L158V

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 558 1.8e-305 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099444
AA Change: L61V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097043
Gene: ENSMUSG00000021461
AA Change: L61V

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 461 5.8e-243 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000159024
AA Change: L175V
SMART Domains Protein: ENSMUSP00000124325
Gene: ENSMUSG00000021461
AA Change: L175V

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 199 1.8e-117 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160151
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160333
Predicted Effect unknown
Transcript: ENSMUST00000160735
AA Change: L71V
SMART Domains Protein: ENSMUSP00000125710
Gene: ENSMUSG00000021461
AA Change: L71V

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 91 5.1e-37 PFAM
Pfam:Fanconi_C 86 117 5.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161507
Predicted Effect possibly damaging
Transcript: ENSMUST00000161977
AA Change: L158V

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123817
Gene: ENSMUSG00000021461
AA Change: L158V

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 558 1.8e-305 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162375
AA Change: L158V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124759
Gene: ENSMUSG00000021461
AA Change: L158V

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 212 1.6e-125 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162971
AA Change: L158V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123972
Gene: ENSMUSG00000021461
AA Change: L158V

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 229 5.7e-136 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163091
AA Change: L158V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124406
Gene: ENSMUSG00000021461
AA Change: L158V

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 517 4.8e-238 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000220684
AA Change: L158V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221054
Meta Mutation Damage Score 0.198 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 91% (32/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are grossly normal, but chromosome aberrations and sensitivity to DNA crosslinkers are seen. Both sexes have fewer germ cell numbers and impaired fertility. Marrow progenitors show decrease in colony forming ability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,090,050 Y54C probably damaging Het
Ash1l A G 3: 89,070,527 H2719R probably damaging Het
Atraid A G 5: 31,052,866 N127D probably damaging Het
Capzb T C 4: 139,280,013 V145A probably benign Het
Cldn17 A C 16: 88,506,571 L90R probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Fcamr T C 1: 130,803,190 L60P probably benign Het
G6pd2 C T 5: 61,809,871 R330C probably benign Het
Gm16432 A G 1: 178,111,558 N666D possibly damaging Het
Gm4788 T A 1: 139,754,335 R174S probably damaging Het
Gpr158 A T 2: 21,399,416 N333I probably damaging Het
Herpud2 A G 9: 25,150,834 Y45H probably damaging Het
Icam5 A G 9: 21,038,749 Y868C probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Homo
Luzp1 C A 4: 136,541,266 Q267K probably benign Het
Nkpd1 C A 7: 19,524,603 A769E possibly damaging Het
Olfr482 AACTCTGTCACT AACT 7: 108,095,525 probably null Het
Pabpc4l C A 3: 46,446,703 V169L probably damaging Het
Pcdhga7 A G 18: 37,716,082 N381D probably damaging Het
Pcsk1 A T 13: 75,115,255 N372Y possibly damaging Het
Ppp1r21 C T 17: 88,569,185 T475M possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Psd2 G A 18: 36,006,723 probably null Het
Psip1 T C 4: 83,474,373 K100E probably benign Het
Pxdn A G 12: 30,003,112 H1096R probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc16a8 C T 15: 79,252,937 G91D probably damaging Het
Slc22a21 A T 11: 53,958,038 I296N probably damaging Het
Smad9 A G 3: 54,789,186 D224G probably benign Het
Tle2 G A 10: 81,588,872 V678M probably damaging Het
Tmc1 C T 19: 20,789,590 R749Q possibly damaging Het
Tmco3 T A 8: 13,292,077 probably null Het
Tspoap1 A G 11: 87,761,703 E101G possibly damaging Het
Zfp57 A T 17: 37,010,411 T386S probably benign Het
Other mutations in Fancc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Fancc APN 13 63400245 missense probably damaging 1.00
IGL00846:Fancc APN 13 63340456 missense possibly damaging 0.89
IGL01404:Fancc APN 13 63361638 missense probably damaging 1.00
IGL02592:Fancc APN 13 63360197 missense probably damaging 1.00
IGL02625:Fancc APN 13 63398151 missense probably damaging 0.99
canneloni UTSW 13 63331823 intron probably benign
macaroni UTSW 13 63321865 critical splice donor site probably null
R0362:Fancc UTSW 13 63398156 missense possibly damaging 0.86
R0554:Fancc UTSW 13 63317469 missense probably benign 0.32
R0626:Fancc UTSW 13 63317391 missense probably damaging 0.97
R0627:Fancc UTSW 13 63317478 missense probably damaging 0.99
R0726:Fancc UTSW 13 63323411 missense probably benign 0.01
R0734:Fancc UTSW 13 63331842 missense probably damaging 1.00
R1363:Fancc UTSW 13 63361598 missense probably damaging 1.00
R1587:Fancc UTSW 13 63340432 missense probably benign 0.32
R1922:Fancc UTSW 13 63330567 missense possibly damaging 0.89
R4585:Fancc UTSW 13 63347564 missense probably benign 0.14
R4586:Fancc UTSW 13 63347564 missense probably benign 0.14
R4608:Fancc UTSW 13 63331823 intron probably benign
R5159:Fancc UTSW 13 63321865 critical splice donor site probably null
R5401:Fancc UTSW 13 63402953 missense probably damaging 1.00
R5561:Fancc UTSW 13 63317387 missense possibly damaging 0.85
R5699:Fancc UTSW 13 63330632 splice site probably null
R6448:Fancc UTSW 13 63340428 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCCTGTGACTGCTAAGAGAAG -3'
(R):5'- TGTAGAAACCCACATGGCAGC -3'

Sequencing Primer
(F):5'- CCTGTGACTGCTAAGAGAAGAGTGG -3'
(R):5'- CAGCCAGTGTGATGTGACAC -3'
Posted On2018-02-27