Incidental Mutation 'R6200:Pcsk1'
ID503156
Institutional Source Beutler Lab
Gene Symbol Pcsk1
Ensembl Gene ENSMUSG00000021587
Gene Nameproprotein convertase subtilisin/kexin type 1
SynonymsPC3, PC1, Nec-1, SPC3, prohormone convertase 1/3, Nec1, Phpp-1
MMRRC Submission 044340-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6200 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location75089826-75134861 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75115255 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 372 (N372Y)
Ref Sequence ENSEMBL: ENSMUSP00000022075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022075]
PDB Structure
Solution Structure of the Mouse Prohormone Convertase 1 Pro-Domain [SOLUTION NMR]
PC1/3 DCSG sorting domain structure in DPC [SOLUTION NMR]
PC1/3 DCSG sorting domain in CHAPS [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022075
AA Change: N372Y

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022075
Gene: ENSMUSG00000021587
AA Change: N372Y

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:S8_pro-domain 34 110 6.4e-26 PFAM
Pfam:Peptidase_S8 158 442 2.2e-49 PFAM
Pfam:P_proprotein 504 591 6.1e-30 PFAM
low complexity region 679 694 N/A INTRINSIC
Pfam:Proho_convert 713 751 4.3e-26 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000222727
AA Change: N64Y
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 91% (32/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to subcellular compartments where a second autocatalytic even takes place and the catalytic activity is acquired. The protease is packaged into and activated in dense core secretory granules and expressed in the neuroendocrine system and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. It functions in the proteolytic activation of polypeptide hormones and neuropeptides precursors. Mutations in this gene have been associated with susceptibility to obesity and proprotein convertase 1/3 deficiency. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele show pre- and postnatal death, low weight, diarrhea, hypoglycemia, low insulin and GHRH levels, and lack mature glucagon and ACTH levels. Homozygotes for another null allele die prior to implantation. ENU mutants show obesity, polyphagia and higher metabolic efficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,090,050 Y54C probably damaging Het
Ash1l A G 3: 89,070,527 H2719R probably damaging Het
Atraid A G 5: 31,052,866 N127D probably damaging Het
Capzb T C 4: 139,280,013 V145A probably benign Het
Cldn17 A C 16: 88,506,571 L90R probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Fancc A C 13: 63,360,248 L158V probably damaging Het
Fcamr T C 1: 130,803,190 L60P probably benign Het
G6pd2 C T 5: 61,809,871 R330C probably benign Het
Gm16432 A G 1: 178,111,558 N666D possibly damaging Het
Gm4788 T A 1: 139,754,335 R174S probably damaging Het
Gpr158 A T 2: 21,399,416 N333I probably damaging Het
Herpud2 A G 9: 25,150,834 Y45H probably damaging Het
Icam5 A G 9: 21,038,749 Y868C probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Homo
Luzp1 C A 4: 136,541,266 Q267K probably benign Het
Nkpd1 C A 7: 19,524,603 A769E possibly damaging Het
Olfr482 AACTCTGTCACT AACT 7: 108,095,525 probably null Het
Pabpc4l C A 3: 46,446,703 V169L probably damaging Het
Pcdhga7 A G 18: 37,716,082 N381D probably damaging Het
Ppp1r21 C T 17: 88,569,185 T475M possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Psd2 G A 18: 36,006,723 probably null Het
Psip1 T C 4: 83,474,373 K100E probably benign Het
Pxdn A G 12: 30,003,112 H1096R probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc16a8 C T 15: 79,252,937 G91D probably damaging Het
Slc22a21 A T 11: 53,958,038 I296N probably damaging Het
Smad9 A G 3: 54,789,186 D224G probably benign Het
Tle2 G A 10: 81,588,872 V678M probably damaging Het
Tmc1 C T 19: 20,789,590 R749Q possibly damaging Het
Tmco3 T A 8: 13,292,077 probably null Het
Tspoap1 A G 11: 87,761,703 E101G possibly damaging Het
Zfp57 A T 17: 37,010,411 T386S probably benign Het
Other mutations in Pcsk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Pcsk1 APN 13 75132087 missense probably benign
IGL01554:Pcsk1 APN 13 75132307 missense probably benign
IGL01960:Pcsk1 APN 13 75093167 missense possibly damaging 0.82
IGL02026:Pcsk1 APN 13 75112653 missense probably benign 0.16
IGL02047:Pcsk1 APN 13 75097989 missense probably benign 0.33
IGL02264:Pcsk1 APN 13 75105959 missense probably damaging 1.00
IGL02441:Pcsk1 APN 13 75132163 missense probably benign 0.16
IGL02795:Pcsk1 APN 13 75112620 missense probably damaging 1.00
IGL02829:Pcsk1 APN 13 75126836 missense probably damaging 1.00
IGL03116:Pcsk1 APN 13 75132216 missense probably damaging 0.99
IGL03156:Pcsk1 APN 13 75131951 missense probably benign
clipper UTSW 13 75130070 missense probably damaging 1.00
PIT4453001:Pcsk1 UTSW 13 75112650 missense probably damaging 1.00
R0771:Pcsk1 UTSW 13 75132162 missense probably benign 0.31
R0894:Pcsk1 UTSW 13 75097977 missense probably damaging 1.00
R1014:Pcsk1 UTSW 13 75132234 missense probably damaging 1.00
R1035:Pcsk1 UTSW 13 75132119 missense probably benign
R1199:Pcsk1 UTSW 13 75096413 splice site probably benign
R1517:Pcsk1 UTSW 13 75098047 nonsense probably null
R1625:Pcsk1 UTSW 13 75126852 missense probably benign 0.11
R1691:Pcsk1 UTSW 13 75132225 missense possibly damaging 0.65
R1717:Pcsk1 UTSW 13 75110828 missense probably damaging 0.99
R2168:Pcsk1 UTSW 13 75112534 intron probably benign
R2252:Pcsk1 UTSW 13 75126726 missense probably benign 0.00
R2400:Pcsk1 UTSW 13 75090126 missense probably benign 0.00
R4110:Pcsk1 UTSW 13 75096369 missense probably damaging 0.99
R4358:Pcsk1 UTSW 13 75112719 missense possibly damaging 0.58
R4359:Pcsk1 UTSW 13 75112719 missense possibly damaging 0.58
R4657:Pcsk1 UTSW 13 75132235 missense probably damaging 1.00
R5195:Pcsk1 UTSW 13 75126855 missense probably damaging 1.00
R5669:Pcsk1 UTSW 13 75130102 missense probably benign 0.01
R5671:Pcsk1 UTSW 13 75097907 missense possibly damaging 0.63
R5745:Pcsk1 UTSW 13 75131960 missense probably benign 0.03
R6107:Pcsk1 UTSW 13 75127848 missense probably benign 0.09
R6326:Pcsk1 UTSW 13 75132179 missense possibly damaging 0.89
R6537:Pcsk1 UTSW 13 75132239 missense probably damaging 1.00
R6541:Pcsk1 UTSW 13 75125984 missense probably damaging 1.00
R6567:Pcsk1 UTSW 13 75130070 missense probably damaging 1.00
R6723:Pcsk1 UTSW 13 75093069 splice site probably null
R7258:Pcsk1 UTSW 13 75093186 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCTTGATGCCAGAATTATAGAC -3'
(R):5'- TCAAAGTGGCAGGATTATCTGG -3'

Sequencing Primer
(F):5'- GCCAGAATTATAGACAAGTTGCAC -3'
(R):5'- AAAGTGGCAGGATTATCTGGATTTTG -3'
Posted On2018-02-27