Incidental Mutation 'R6200:Slc16a8'
ID503157
Institutional Source Beutler Lab
Gene Symbol Slc16a8
Ensembl Gene ENSMUSG00000032988
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 8
Synonymsproton-coupled monocarboxylate transporter 3, Mct3
MMRRC Submission 044340-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R6200 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location79251014-79254761 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 79252937 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 91 (G91D)
Ref Sequence ENSEMBL: ENSMUSP00000040522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018295] [ENSMUST00000039752] [ENSMUST00000053926] [ENSMUST00000163571] [ENSMUST00000166155]
Predicted Effect probably benign
Transcript: ENSMUST00000018295
SMART Domains Protein: ENSMUSP00000018295
Gene: ENSMUSG00000068206

DomainStartEndE-ValueType
PDZ 31 105 2.12e-13 SMART
Arfaptin 117 352 1.69e-122 SMART
low complexity region 380 391 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000039752
AA Change: G91D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040522
Gene: ENSMUSG00000032988
AA Change: G91D

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
Pfam:MFS_1 20 349 1.3e-28 PFAM
transmembrane domain 353 372 N/A INTRINSIC
transmembrane domain 387 409 N/A INTRINSIC
low complexity region 465 480 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053926
SMART Domains Protein: ENSMUSP00000061125
Gene: ENSMUSG00000116121

DomainStartEndE-ValueType
PDZ 31 105 2.12e-13 SMART
Arfaptin 117 363 1.18e-103 SMART
GLECT 393 530 7.99e-3 SMART
Gal-bind_lectin 399 530 4.49e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163571
SMART Domains Protein: ENSMUSP00000128126
Gene: ENSMUSG00000068206

DomainStartEndE-ValueType
PDZ 31 105 2.12e-13 SMART
Arfaptin 117 352 1.69e-122 SMART
low complexity region 380 391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165609
Predicted Effect probably benign
Transcript: ENSMUST00000166155
SMART Domains Protein: ENSMUSP00000129468
Gene: ENSMUSG00000068206

DomainStartEndE-ValueType
PDZ 31 105 2.12e-13 SMART
Arfaptin 117 352 1.69e-122 SMART
low complexity region 380 391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230477
Meta Mutation Damage Score 0.628 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 91% (32/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC16A8 is a member of a family of proton-coupled monocarboxylate transporters that mediate lactate transport across cell membranes (Yoon et al., 1999 [PubMed 10493836]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced visual function, putatively due to changes in the ionic composition of the outer retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,090,050 Y54C probably damaging Het
Ash1l A G 3: 89,070,527 H2719R probably damaging Het
Atraid A G 5: 31,052,866 N127D probably damaging Het
Capzb T C 4: 139,280,013 V145A probably benign Het
Cldn17 A C 16: 88,506,571 L90R probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Fancc A C 13: 63,360,248 L158V probably damaging Het
Fcamr T C 1: 130,803,190 L60P probably benign Het
G6pd2 C T 5: 61,809,871 R330C probably benign Het
Gm16432 A G 1: 178,111,558 N666D possibly damaging Het
Gm4788 T A 1: 139,754,335 R174S probably damaging Het
Gpr158 A T 2: 21,399,416 N333I probably damaging Het
Herpud2 A G 9: 25,150,834 Y45H probably damaging Het
Icam5 A G 9: 21,038,749 Y868C probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Homo
Luzp1 C A 4: 136,541,266 Q267K probably benign Het
Nkpd1 C A 7: 19,524,603 A769E possibly damaging Het
Olfr482 AACTCTGTCACT AACT 7: 108,095,525 probably null Het
Pabpc4l C A 3: 46,446,703 V169L probably damaging Het
Pcdhga7 A G 18: 37,716,082 N381D probably damaging Het
Pcsk1 A T 13: 75,115,255 N372Y possibly damaging Het
Ppp1r21 C T 17: 88,569,185 T475M possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Psd2 G A 18: 36,006,723 probably null Het
Psip1 T C 4: 83,474,373 K100E probably benign Het
Pxdn A G 12: 30,003,112 H1096R probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc22a21 A T 11: 53,958,038 I296N probably damaging Het
Smad9 A G 3: 54,789,186 D224G probably benign Het
Tle2 G A 10: 81,588,872 V678M probably damaging Het
Tmc1 C T 19: 20,789,590 R749Q possibly damaging Het
Tmco3 T A 8: 13,292,077 probably null Het
Tspoap1 A G 11: 87,761,703 E101G possibly damaging Het
Zfp57 A T 17: 37,010,411 T386S probably benign Het
Other mutations in Slc16a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Slc16a8 APN 15 79251232 missense probably damaging 0.97
R0440:Slc16a8 UTSW 15 79252607 missense probably damaging 1.00
R2239:Slc16a8 UTSW 15 79252947 missense probably damaging 0.96
R3157:Slc16a8 UTSW 15 79252175 missense probably damaging 1.00
R4967:Slc16a8 UTSW 15 79252884 missense possibly damaging 0.85
R6899:Slc16a8 UTSW 15 79253749 missense possibly damaging 0.72
R7267:Slc16a8 UTSW 15 79251925 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GACCTCCGACAGAAAGGATG -3'
(R):5'- CTCTGCTTCTGAAGGGGATG -3'

Sequencing Primer
(F):5'- ATGCTGAGCCATGCGACTC -3'
(R):5'- CTGCTTCTGAAGGGGATGAGGAG -3'
Posted On2018-02-27