Incidental Mutation 'R6200:Cldn17'
ID503159
Institutional Source Beutler Lab
Gene Symbol Cldn17
Ensembl Gene ENSMUSG00000055811
Gene Nameclaudin 17
Synonyms
MMRRC Submission 044340-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R6200 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location88505807-88506978 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 88506571 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 90 (L90R)
Ref Sequence ENSEMBL: ENSMUSP00000066427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069549]
Predicted Effect probably damaging
Transcript: ENSMUST00000069549
AA Change: L90R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066427
Gene: ENSMUSG00000055811
AA Change: L90R

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 182 9.8e-29 PFAM
Pfam:Claudin_2 16 184 2.6e-9 PFAM
Meta Mutation Damage Score 0.314 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 91% (32/35)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is intronless and is clustered with the Cldn8 gene on chromosome 16. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,090,050 Y54C probably damaging Het
Ash1l A G 3: 89,070,527 H2719R probably damaging Het
Atraid A G 5: 31,052,866 N127D probably damaging Het
Capzb T C 4: 139,280,013 V145A probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Fancc A C 13: 63,360,248 L158V probably damaging Het
Fcamr T C 1: 130,803,190 L60P probably benign Het
G6pd2 C T 5: 61,809,871 R330C probably benign Het
Gm16432 A G 1: 178,111,558 N666D possibly damaging Het
Gm4788 T A 1: 139,754,335 R174S probably damaging Het
Gpr158 A T 2: 21,399,416 N333I probably damaging Het
Herpud2 A G 9: 25,150,834 Y45H probably damaging Het
Icam5 A G 9: 21,038,749 Y868C probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Homo
Luzp1 C A 4: 136,541,266 Q267K probably benign Het
Nkpd1 C A 7: 19,524,603 A769E possibly damaging Het
Olfr482 AACTCTGTCACT AACT 7: 108,095,525 probably null Het
Pabpc4l C A 3: 46,446,703 V169L probably damaging Het
Pcdhga7 A G 18: 37,716,082 N381D probably damaging Het
Pcsk1 A T 13: 75,115,255 N372Y possibly damaging Het
Ppp1r21 C T 17: 88,569,185 T475M possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Psd2 G A 18: 36,006,723 probably null Het
Psip1 T C 4: 83,474,373 K100E probably benign Het
Pxdn A G 12: 30,003,112 H1096R probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc16a8 C T 15: 79,252,937 G91D probably damaging Het
Slc22a21 A T 11: 53,958,038 I296N probably damaging Het
Smad9 A G 3: 54,789,186 D224G probably benign Het
Tle2 G A 10: 81,588,872 V678M probably damaging Het
Tmc1 C T 19: 20,789,590 R749Q possibly damaging Het
Tmco3 T A 8: 13,292,077 probably null Het
Tspoap1 A G 11: 87,761,703 E101G possibly damaging Het
Zfp57 A T 17: 37,010,411 T386S probably benign Het
Other mutations in Cldn17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00667:Cldn17 APN 16 88506157 utr 3 prime probably benign
IGL01481:Cldn17 APN 16 88506583 missense probably benign 0.03
IGL01505:Cldn17 APN 16 88506703 missense possibly damaging 0.67
IGL03100:Cldn17 APN 16 88506601 missense probably damaging 1.00
R1721:Cldn17 UTSW 16 88506556 missense probably damaging 1.00
R5944:Cldn17 UTSW 16 88506709 missense probably damaging 1.00
R6750:Cldn17 UTSW 16 88506307 missense possibly damaging 0.88
X0025:Cldn17 UTSW 16 88506392 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGAAGAGTGCTCCTCCAAG -3'
(R):5'- AGCTTTCATCGGCAGCAAC -3'

Sequencing Primer
(F):5'- GGAAGAGTGCTCCTCCAAGTTCTC -3'
(R):5'- CGGCAGCAACATTATTATCTTTGAG -3'
Posted On2018-02-27