Incidental Mutation 'R6207:Tulp1'
ID503226
Institutional Source Beutler Lab
Gene Symbol Tulp1
Ensembl Gene ENSMUSG00000037446
Gene Nametubby like protein 1
SynonymsTulp1l
MMRRC Submission 044341-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.506) question?
Stock #R6207 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location28351515-28365182 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 28358677 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041819] [ENSMUST00000114794] [ENSMUST00000123797] [ENSMUST00000129375]
Predicted Effect probably benign
Transcript: ENSMUST00000041819
SMART Domains Protein: ENSMUSP00000049070
Gene: ENSMUSG00000037446

DomainStartEndE-ValueType
internal_repeat_1 17 65 8.47e-7 PROSPERO
low complexity region 111 142 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
internal_repeat_1 160 212 8.47e-7 PROSPERO
coiled coil region 242 266 N/A INTRINSIC
Pfam:Tub 299 537 1.8e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114794
SMART Domains Protein: ENSMUSP00000110442
Gene: ENSMUSG00000037446

DomainStartEndE-ValueType
internal_repeat_1 17 65 8.5e-7 PROSPERO
low complexity region 111 142 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
internal_repeat_1 160 212 8.5e-7 PROSPERO
coiled coil region 242 266 N/A INTRINSIC
Pfam:Tub 299 449 3.4e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123797
SMART Domains Protein: ENSMUSP00000116588
Gene: ENSMUSG00000037446

DomainStartEndE-ValueType
Pfam:Tub 21 228 2.1e-88 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125876
Predicted Effect probably benign
Transcript: ENSMUST00000129375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142143
Predicted Effect unknown
Transcript: ENSMUST00000148188
AA Change: S6T
SMART Domains Protein: ENSMUSP00000116844
Gene: ENSMUSG00000037446
AA Change: S6T

DomainStartEndE-ValueType
Pfam:Tub 5 214 8.8e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150341
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tubby-like gene family (TULPs). Members of this family have been identified in plants, vertebrates, and invertebrates. TULP proteins share a conserved C-terminal region of approximately 200 amino acid residues. The protein encoded by this gene is thought to play a role in the physiology of photoreceptors. Mutations in this gene are associated with recessive juvenile retinitis pigmentosa and Leber congenital amaurosis-15. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mutant mice exhibit retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451I11Rik G A 7: 126,830,893 P69S probably damaging Het
Abca15 A G 7: 120,373,794 R864G probably benign Het
Acbd5 T C 2: 23,069,478 C15R possibly damaging Het
Ahctf1 A T 1: 179,777,390 probably null Het
Ak3 T A 19: 29,022,940 K190N probably damaging Het
B4galnt3 A T 6: 120,206,614 probably null Het
Calcrl T C 2: 84,333,530 H439R probably benign Het
Casp7 T A 19: 56,441,020 D279E possibly damaging Het
Cckar A G 5: 53,699,844 V337A probably benign Het
Cep85l T C 10: 53,281,555 Y684C probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Homo
Commd7 T C 2: 153,632,610 N23S possibly damaging Het
Cpne9 A T 6: 113,294,773 I365F possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dot1l C T 10: 80,786,443 A831V probably benign Het
Epcam C A 17: 87,640,436 N111K probably damaging Het
Etnk1 A G 6: 143,180,798 Q123R probably damaging Het
Fam170a A T 18: 50,281,950 E221V probably damaging Het
Fam189a2 T C 19: 23,973,438 E593G probably damaging Het
Fbl T C 7: 28,174,853 S88P possibly damaging Het
Fbxo36 T A 1: 84,896,530 Y82* probably null Het
Fer1l5 A G 1: 36,385,160 K285R probably damaging Het
Foxn3 G T 12: 99,196,310 T444K probably damaging Het
Gak C T 5: 108,625,029 probably null Het
Gprc6a T C 10: 51,626,835 I311V probably benign Het
Hrg T C 16: 22,954,538 probably null Het
Htatip2 G A 7: 49,770,819 V138I probably benign Het
Ighv1-4 A T 12: 114,487,522 probably benign Het
Kcnq2 T C 2: 181,113,233 M174V possibly damaging Het
Krt39 G T 11: 99,521,215 P15Q probably damaging Het
L1td1 G A 4: 98,737,418 D617N possibly damaging Het
Lgalsl T A 11: 20,829,382 K88* probably null Het
Lims1 A T 10: 58,394,564 K49M possibly damaging Het
Man2a1 T C 17: 64,713,605 V792A probably benign Het
Mcm2 G T 6: 88,885,862 D749E probably benign Het
Mdga1 G A 17: 29,838,517 T775M probably damaging Het
Myb A G 10: 21,145,322 S403P probably benign Het
Nek6 T C 2: 38,557,834 S37P possibly damaging Het
Olfr149 T C 9: 39,702,310 H153R probably benign Het
Olfr310 A C 7: 86,269,760 F10V probably damaging Het
Olfr622 A G 7: 103,640,002 V46A probably benign Het
Olfr663 G A 7: 104,703,611 V15M probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Prune2 T A 19: 17,118,116 I328N probably damaging Het
Psap T A 10: 60,300,538 C484S probably damaging Het
Pus1 T C 5: 110,777,714 D80G probably benign Het
Rasa3 T C 8: 13,598,251 T138A possibly damaging Het
Scaf1 G T 7: 45,007,623 probably benign Het
Skap1 T A 11: 96,704,133 Y143* probably null Het
Slc22a20 A G 19: 5,985,941 L67P probably damaging Het
Slc25a17 T C 15: 81,329,064 Y146C probably damaging Het
Slfn4 C T 11: 83,189,125 T154I possibly damaging Het
Snai1 T A 2: 167,538,309 V7D probably damaging Het
Snrnp200 T A 2: 127,210,735 M84K probably benign Het
Spop G T 11: 95,471,237 K31N possibly damaging Het
Surf1 T C 2: 26,914,807 T145A probably benign Het
Tbkbp1 T C 11: 97,146,339 E278G probably damaging Het
Thumpd2 G A 17: 81,055,837 A67V probably damaging Het
Timd4 A T 11: 46,815,526 M52L probably damaging Het
Trav16 A T 14: 53,743,588 N78I probably damaging Het
Tspan12 T C 6: 21,799,908 T147A probably damaging Het
Ubqlnl A T 7: 104,148,708 N527K possibly damaging Het
Ubr4 G A 4: 139,421,248 C1681Y probably damaging Het
Unc13c T C 9: 73,758,628 K1037E possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r4 G A 3: 64,406,505 H352Y probably damaging Het
Vmn2r61 A T 7: 42,260,192 H47L probably benign Het
Vwa5a A G 9: 38,722,672 E57G probably damaging Het
Zfp180 A T 7: 24,105,085 R310* probably null Het
Zfp672 T C 11: 58,317,523 probably benign Het
Other mutations in Tulp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01952:Tulp1 APN 17 28356424 missense probably damaging 1.00
IGL01955:Tulp1 APN 17 28356424 missense probably damaging 1.00
IGL02388:Tulp1 APN 17 28358659 missense probably damaging 1.00
IGL02511:Tulp1 APN 17 28356168 missense probably benign 0.15
IGL02973:Tulp1 APN 17 28358542 splice site probably benign
IGL03054:Tulp1 APN 17 28359313 unclassified probably benign
IGL03248:Tulp1 APN 17 28359324 missense possibly damaging 0.87
R1017:Tulp1 UTSW 17 28364303 missense probably damaging 1.00
R1543:Tulp1 UTSW 17 28362671 unclassified probably benign
R1593:Tulp1 UTSW 17 28362701 missense probably damaging 0.97
R1826:Tulp1 UTSW 17 28356367 missense possibly damaging 0.89
R2323:Tulp1 UTSW 17 28362482 missense probably damaging 1.00
R3840:Tulp1 UTSW 17 28353715 missense probably damaging 1.00
R3841:Tulp1 UTSW 17 28353715 missense probably damaging 1.00
R3930:Tulp1 UTSW 17 28353709 missense probably damaging 1.00
R4690:Tulp1 UTSW 17 28351837 unclassified probably benign
R4823:Tulp1 UTSW 17 28353572 missense probably benign 0.01
R4916:Tulp1 UTSW 17 28359135 missense probably damaging 1.00
R5024:Tulp1 UTSW 17 28351995 nonsense probably null
R5159:Tulp1 UTSW 17 28359060 critical splice donor site probably null
R5249:Tulp1 UTSW 17 28362677 unclassified probably benign
R5567:Tulp1 UTSW 17 28359198 missense possibly damaging 0.47
R6072:Tulp1 UTSW 17 28363784 missense possibly damaging 0.71
R6127:Tulp1 UTSW 17 28356150 missense probably benign
R6416:Tulp1 UTSW 17 28356031 makesense probably null
R6773:Tulp1 UTSW 17 28362902 missense probably damaging 1.00
R7242:Tulp1 UTSW 17 28363405 intron probably null
R7323:Tulp1 UTSW 17 28356424 missense probably damaging 1.00
R7542:Tulp1 UTSW 17 28363755 missense probably benign 0.26
X0024:Tulp1 UTSW 17 28353697 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCGAAATGTCCTAGGCCGG -3'
(R):5'- TGCACCTGGACACTGAGAAG -3'

Sequencing Primer
(F):5'- AGACTTCTCTGGAGCACCC -3'
(R):5'- TGGAGCACGTCTAAGGCTG -3'
Posted On2018-02-27