Incidental Mutation 'R6208:Map2'
ID503237
Institutional Source Beutler Lab
Gene Symbol Map2
Ensembl Gene ENSMUSG00000015222
Gene Namemicrotubule-associated protein 2
Synonymsrepro4, MAP-2, Mtap2, G1-397-34
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.506) question?
Stock #R6208 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location66175273-66442583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66431590 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 328 (N328D)
Ref Sequence ENSEMBL: ENSMUSP00000134651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024639] [ENSMUST00000077355] [ENSMUST00000114012] [ENSMUST00000114013] [ENSMUST00000114015] [ENSMUST00000114017] [ENSMUST00000114018] [ENSMUST00000172886] [ENSMUST00000173778] [ENSMUST00000173800]
Predicted Effect probably benign
Transcript: ENSMUST00000024639
SMART Domains Protein: ENSMUSP00000024639
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077355
SMART Domains Protein: ENSMUSP00000076577
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083760
Predicted Effect probably benign
Transcript: ENSMUST00000114012
SMART Domains Protein: ENSMUSP00000109645
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 133 140 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 205 221 N/A INTRINSIC
low complexity region 228 250 N/A INTRINSIC
Pfam:Tubulin-binding 299 330 2.1e-18 PFAM
Pfam:Tubulin-binding 331 361 9.1e-20 PFAM
Pfam:Tubulin-binding 362 393 1.7e-17 PFAM
low complexity region 421 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114013
SMART Domains Protein: ENSMUSP00000109646
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:RII_binding_1 86 103 1.2e-5 PFAM
low complexity region 120 141 N/A INTRINSIC
Pfam:MAP2_projctn 376 1510 N/A PFAM
low complexity region 1543 1557 N/A INTRINSIC
low complexity region 1567 1583 N/A INTRINSIC
low complexity region 1590 1612 N/A INTRINSIC
Pfam:Tubulin-binding 1662 1692 1.7e-13 PFAM
Pfam:Tubulin-binding 1693 1723 5.8e-18 PFAM
Pfam:Tubulin-binding 1724 1755 5.9e-18 PFAM
low complexity region 1783 1796 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114015
SMART Domains Protein: ENSMUSP00000109648
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114017
AA Change: N353D

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109650
Gene: ENSMUSG00000015222
AA Change: N353D

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114018
AA Change: N353D

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109651
Gene: ENSMUSG00000015222
AA Change: N353D

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151423
Predicted Effect probably benign
Transcript: ENSMUST00000172486
SMART Domains Protein: ENSMUSP00000134187
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:Tubulin-binding 12 41 2.5e-17 PFAM
low complexity region 65 81 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172886
AA Change: N283D

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133446
Gene: ENSMUSG00000015222
AA Change: N283D

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 107 3.9e-54 PFAM
low complexity region 112 126 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
low complexity region 159 181 N/A INTRINSIC
Pfam:Tubulin-binding 230 261 1.4e-18 PFAM
Pfam:Tubulin-binding 262 292 1.4e-19 PFAM
Pfam:Tubulin-binding 293 323 6e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173778
AA Change: N328D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134651
Gene: ENSMUSG00000015222
AA Change: N328D

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 124 4.8e-84 PFAM
low complexity region 157 171 N/A INTRINSIC
low complexity region 181 197 N/A INTRINSIC
low complexity region 204 226 N/A INTRINSIC
Pfam:Tubulin-binding 275 306 1.6e-18 PFAM
Pfam:Tubulin-binding 307 337 1.6e-19 PFAM
Pfam:Tubulin-binding 338 368 7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173800
SMART Domains Protein: ENSMUSP00000134518
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 23 2.2e-11 PFAM
low complexity region 55 69 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 102 124 N/A INTRINSIC
Pfam:Tubulin-binding 173 204 8.7e-19 PFAM
Pfam:Tubulin-binding 205 235 3.8e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The products of similar genes in rat and mouse are neuron-specific cytoskeletal proteins that are enriched in dentrites, implicating a role in determining and stabilizing dentritic shape during neuron development. A number of alternatively spliced variants encoding distinct isoforms have been described. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered contextual memory. Mice homozygous for another knock-out allele display decreased body weight, altered microtubule density and organization in Purkinje cell dendrites, and reduced dendritic length inhippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A T 3: 32,711,894 I18F probably benign Het
Apol11a C T 15: 77,517,041 R243C probably damaging Het
Asap3 A G 4: 136,241,197 M687V probably benign Het
Axdnd1 C T 1: 156,392,856 probably benign Het
Baz2b A G 2: 59,924,806 F1026S probably damaging Het
Bsg T C 10: 79,708,838 L70P probably damaging Het
Col10a1 A G 10: 34,394,586 N185D possibly damaging Het
Col6a2 T A 10: 76,615,057 N50I possibly damaging Het
Cux2 G A 5: 121,860,822 P1352S possibly damaging Het
Defa25 A G 8: 21,085,181 probably null Het
Emc1 G T 4: 139,354,271 R70L probably damaging Het
Fat1 T C 8: 45,027,613 F3028S probably damaging Het
Fhit T C 14: 9,573,435 E205G probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm20830 T G Y: 6,916,792 E109A probably benign Homo
Grm1 A T 10: 10,719,946 F646Y probably damaging Het
Hp1bp3 A G 4: 138,217,170 probably benign Het
Lce1d G A 3: 92,686,005 P34S unknown Het
Lpar1 G A 4: 58,504,630 Q13* probably null Het
Lrrc61 C T 6: 48,568,905 R221* probably null Het
Mndal T A 1: 173,857,422 D527V possibly damaging Het
Mycbp2 T G 14: 103,295,228 N430T probably benign Het
Myo1e A G 9: 70,376,605 Y861C probably damaging Het
Nav2 A G 7: 49,564,103 T1622A probably damaging Het
Nom1 A T 5: 29,449,619 H773L possibly damaging Het
Npc2 G T 12: 84,757,145 P144Q probably damaging Het
Npnt A G 3: 132,950,013 probably benign Het
Nxpe4 A T 9: 48,393,378 Y255F probably benign Het
Obscn G A 11: 59,067,648 A3769V possibly damaging Het
Optc T C 1: 133,904,999 D121G probably damaging Het
Pard6a T C 8: 105,702,234 F26L probably damaging Het
Pcdhga4 T A 18: 37,686,709 I437N probably damaging Het
Phf12 G T 11: 78,023,591 V71F probably damaging Het
Phf21b T A 15: 84,795,116 S282C probably damaging Het
Pou5f1 T C 17: 35,510,460 F323S possibly damaging Het
Psmd5 A T 2: 34,867,011 I67N probably damaging Het
Pyroxd1 A G 6: 142,357,456 K273R probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpusd1 A T 17: 25,730,378 H174L probably damaging Het
Ryr2 T C 13: 11,895,220 K94R probably benign Het
Scn2b A G 9: 45,118,030 R3G probably benign Het
Sf3b2 A T 19: 5,275,098 M782K possibly damaging Het
Skint7 A G 4: 111,984,876 probably null Het
Slc43a1 A G 2: 84,856,840 I319V possibly damaging Het
Snupn T A 9: 56,982,963 M356K probably damaging Het
Spata31d1a C A 13: 59,700,564 R1250M probably damaging Het
Sprr2h T C 3: 92,386,909 V21A unknown Het
Srpr A G 9: 35,215,995 T614A possibly damaging Het
Stk36 A T 1: 74,611,432 Q327L probably benign Het
Syne3 A G 12: 104,943,363 I738T probably benign Het
Tcea3 A T 4: 136,248,049 M1L probably damaging Het
Tead2 G T 7: 45,218,102 R85L probably damaging Het
Thap7 T C 16: 17,528,436 N228D possibly damaging Het
Trip11 T A 12: 101,898,895 E173V probably damaging Het
Ttc38 T A 15: 85,841,497 M187K possibly damaging Het
Vmn1r193 T A 13: 22,218,968 T285S possibly damaging Het
Vmn2r106 T C 17: 20,268,329 T603A probably damaging Het
Vps39 A T 2: 120,333,416 M355K probably damaging Het
Wnt5b G T 6: 119,446,512 L51I probably damaging Het
Xxylt1 A G 16: 31,007,808 Y230H probably benign Het
Other mutations in Map2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Map2 APN 1 66425331 missense probably damaging 1.00
IGL02135:Map2 APN 1 66380761 nonsense probably null
IGL02526:Map2 APN 1 66380717 missense possibly damaging 0.94
Annas UTSW 1 66433597 critical splice donor site probably null
calliope UTSW 1 66425298 missense probably damaging 1.00
ruby_throat UTSW 1 66414884 missense possibly damaging 0.67
E0370:Map2 UTSW 1 66416724 unclassified probably benign
R0067:Map2 UTSW 1 66413163 missense probably benign 0.04
R0238:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0238:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0239:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0239:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0268:Map2 UTSW 1 66380722 nonsense probably null
R0302:Map2 UTSW 1 66414828 missense probably benign 0.15
R0305:Map2 UTSW 1 66413094 missense probably benign 0.00
R0409:Map2 UTSW 1 66433580 missense probably damaging 1.00
R0561:Map2 UTSW 1 66425497 missense probably damaging 1.00
R0674:Map2 UTSW 1 66413202 missense probably damaging 1.00
R0738:Map2 UTSW 1 66425189 splice site probably benign
R0893:Map2 UTSW 1 66380768 missense probably damaging 1.00
R1305:Map2 UTSW 1 66425395 missense probably damaging 1.00
R1534:Map2 UTSW 1 66413180 missense probably benign 0.33
R1632:Map2 UTSW 1 66415086 missense possibly damaging 0.60
R1682:Map2 UTSW 1 66415622 unclassified probably null
R1774:Map2 UTSW 1 66414074 missense probably damaging 1.00
R2014:Map2 UTSW 1 66416136 missense possibly damaging 0.55
R2017:Map2 UTSW 1 66412799 missense probably damaging 1.00
R2050:Map2 UTSW 1 66414314 missense probably damaging 0.98
R2093:Map2 UTSW 1 66399440 missense probably damaging 1.00
R2214:Map2 UTSW 1 66420186 missense probably damaging 0.99
R2284:Map2 UTSW 1 66414068 missense probably damaging 1.00
R3011:Map2 UTSW 1 66414612 missense probably damaging 1.00
R3105:Map2 UTSW 1 66433597 critical splice donor site probably null
R3708:Map2 UTSW 1 66416555 unclassified probably benign
R3709:Map2 UTSW 1 66415856 nonsense probably null
R3729:Map2 UTSW 1 66412446 missense possibly damaging 0.80
R3760:Map2 UTSW 1 66438918 missense probably damaging 1.00
R3788:Map2 UTSW 1 66416863 missense probably damaging 0.99
R3789:Map2 UTSW 1 66416863 missense probably damaging 0.99
R4003:Map2 UTSW 1 66415740 missense probably damaging 1.00
R4120:Map2 UTSW 1 66415904 missense probably damaging 1.00
R4172:Map2 UTSW 1 66413600 missense possibly damaging 0.89
R4198:Map2 UTSW 1 66425298 missense probably damaging 1.00
R4200:Map2 UTSW 1 66425298 missense probably damaging 1.00
R4205:Map2 UTSW 1 66425290 missense probably damaging 1.00
R4613:Map2 UTSW 1 66425469 missense probably damaging 1.00
R4700:Map2 UTSW 1 66410637 missense probably damaging 0.96
R4974:Map2 UTSW 1 66413505 missense probably benign 0.15
R5007:Map2 UTSW 1 66413289 missense possibly damaging 0.86
R5039:Map2 UTSW 1 66438796 missense probably damaging 1.00
R5237:Map2 UTSW 1 66439010 unclassified probably benign
R5313:Map2 UTSW 1 66425379 missense probably damaging 1.00
R5455:Map2 UTSW 1 66399391 missense probably damaging 1.00
R5490:Map2 UTSW 1 66413133 missense probably damaging 1.00
R5517:Map2 UTSW 1 66415256 missense probably benign 0.00
R5532:Map2 UTSW 1 66414620 missense probably damaging 1.00
R5583:Map2 UTSW 1 66416037 missense probably damaging 1.00
R5764:Map2 UTSW 1 66414875 missense probably damaging 0.99
R5996:Map2 UTSW 1 66414884 missense possibly damaging 0.67
R6058:Map2 UTSW 1 66415414 missense probably benign 0.05
R6199:Map2 UTSW 1 66425478 missense probably damaging 1.00
R6276:Map2 UTSW 1 66399419 missense probably damaging 1.00
R6378:Map2 UTSW 1 66415329 missense probably damaging 1.00
R6424:Map2 UTSW 1 66414787 missense possibly damaging 0.67
R6743:Map2 UTSW 1 66415607 missense probably benign 0.04
R6837:Map2 UTSW 1 66414572 missense probably damaging 1.00
R6901:Map2 UTSW 1 66421773 missense possibly damaging 0.94
R6984:Map2 UTSW 1 66415236 missense possibly damaging 0.90
R6989:Map2 UTSW 1 66414906 missense probably benign 0.00
V8831:Map2 UTSW 1 66415845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCACTTGGCCTTTGAGG -3'
(R):5'- TCCTTCCCAACTGATCTGACAG -3'

Sequencing Primer
(F):5'- CCTTTGAGGCTCCAGGGAAATAG -3'
(R):5'- TTCCCAACTGATCTGACAGAAAAGG -3'
Posted On2018-02-27