Incidental Mutation 'R6208:Npnt'
ID503249
Institutional Source Beutler Lab
Gene Symbol Npnt
Ensembl Gene ENSMUSG00000040998
Gene Namenephronectin
Synonyms1110009H02Rik, POEM
MMRRC Submission 044342-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.518) question?
Stock #R6208 (G1)
Quality Score167.009
Status Validated
Chromosome3
Chromosomal Location132881745-132950291 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 132950013 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042729] [ENSMUST00000042744] [ENSMUST00000093971] [ENSMUST00000117164] [ENSMUST00000117456] [ENSMUST00000117811]
Predicted Effect unknown
Transcript: ENSMUST00000042729
AA Change: S11P
SMART Domains Protein: ENSMUSP00000040071
Gene: ENSMUSG00000040998
AA Change: S11P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 76 104 1.53e-1 SMART
EGF_CA 106 145 1.85e-9 SMART
EGF 149 185 1.73e1 SMART
EGF 189 230 7.53e-1 SMART
EGF_CA 231 271 5.31e-10 SMART
low complexity region 324 383 N/A INTRINSIC
Pfam:MAM 439 578 8.2e-28 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000042744
AA Change: S11P
SMART Domains Protein: ENSMUSP00000040684
Gene: ENSMUSG00000040998
AA Change: S11P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 59 87 7.6e-4 SMART
EGF_CA 89 128 9e-12 SMART
EGF 132 168 8.5e-2 SMART
EGF 172 213 3.5e-3 SMART
EGF_CA 214 254 2.6e-12 SMART
low complexity region 307 366 N/A INTRINSIC
MAM 417 560 1.4e-11 SMART
Predicted Effect unknown
Transcript: ENSMUST00000093971
AA Change: S11P
SMART Domains Protein: ENSMUSP00000091505
Gene: ENSMUSG00000040998
AA Change: S11P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 76 104 1.53e-1 SMART
EGF_CA 137 176 1.85e-9 SMART
EGF 180 216 1.73e1 SMART
EGF 220 261 7.53e-1 SMART
EGF_CA 262 302 5.31e-10 SMART
low complexity region 355 414 N/A INTRINSIC
Pfam:MAM 470 609 1.9e-23 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000117164
AA Change: S11P
SMART Domains Protein: ENSMUSP00000113419
Gene: ENSMUSG00000040998
AA Change: S11P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 59 87 1.53e-1 SMART
EGF_CA 120 159 1.85e-9 SMART
EGF 163 199 1.73e1 SMART
EGF 203 244 7.53e-1 SMART
EGF_CA 245 285 5.31e-10 SMART
low complexity region 338 397 N/A INTRINSIC
Pfam:MAM 453 592 8.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117456
SMART Domains Protein: ENSMUSP00000112816
Gene: ENSMUSG00000040998

DomainStartEndE-ValueType
EGF 28 64 1.73e1 SMART
EGF 68 109 7.53e-1 SMART
EGF_CA 110 150 5.31e-10 SMART
low complexity region 203 262 N/A INTRINSIC
Pfam:MAM 318 457 5.3e-28 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000117811
AA Change: S11P
SMART Domains Protein: ENSMUSP00000113752
Gene: ENSMUSG00000040998
AA Change: S11P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 59 87 1.53e-1 SMART
EGF_CA 89 128 1.85e-9 SMART
EGF 132 168 1.73e1 SMART
EGF 172 213 7.53e-1 SMART
EGF_CA 214 254 5.31e-10 SMART
low complexity region 307 366 N/A INTRINSIC
Pfam:MAM 393 532 3.3e-28 PFAM
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (57/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele frequently exhibit kidney agenesis or hypoplasia attributed to a delay in the invasion of the metanephric mesenchyme by the ureteric bud at an early stage of kidney development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A T 3: 32,711,894 I18F probably benign Het
Apol11a C T 15: 77,517,041 R243C probably damaging Het
Asap3 A G 4: 136,241,197 M687V probably benign Het
Axdnd1 C T 1: 156,392,856 probably benign Het
Baz2b A G 2: 59,924,806 F1026S probably damaging Het
Bsg T C 10: 79,708,838 L70P probably damaging Het
Col10a1 A G 10: 34,394,586 N185D possibly damaging Het
Col6a2 T A 10: 76,615,057 N50I possibly damaging Het
Cux2 G A 5: 121,860,822 P1352S possibly damaging Het
Defa25 A G 8: 21,085,181 probably null Het
Emc1 G T 4: 139,354,271 R70L probably damaging Het
Fat1 T C 8: 45,027,613 F3028S probably damaging Het
Fhit T C 14: 9,573,435 E205G probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm20830 T G Y: 6,916,792 E109A probably benign Homo
Grm1 A T 10: 10,719,946 F646Y probably damaging Het
Hp1bp3 A G 4: 138,217,170 probably benign Het
Lce1d G A 3: 92,686,005 P34S unknown Het
Lpar1 G A 4: 58,504,630 Q13* probably null Het
Lrrc61 C T 6: 48,568,905 R221* probably null Het
Map2 A G 1: 66,431,590 N328D probably damaging Het
Mndal T A 1: 173,857,422 D527V possibly damaging Het
Mycbp2 T G 14: 103,295,228 N430T probably benign Het
Myo1e A G 9: 70,376,605 Y861C probably damaging Het
Nav2 A G 7: 49,564,103 T1622A probably damaging Het
Nom1 A T 5: 29,449,619 H773L possibly damaging Het
Npc2 G T 12: 84,757,145 P144Q probably damaging Het
Nxpe4 A T 9: 48,393,378 Y255F probably benign Het
Obscn G A 11: 59,067,648 A3769V possibly damaging Het
Optc T C 1: 133,904,999 D121G probably damaging Het
Pard6a T C 8: 105,702,234 F26L probably damaging Het
Pcdhga4 T A 18: 37,686,709 I437N probably damaging Het
Phf12 G T 11: 78,023,591 V71F probably damaging Het
Phf21b T A 15: 84,795,116 S282C probably damaging Het
Pou5f1 T C 17: 35,510,460 F323S possibly damaging Het
Psmd5 A T 2: 34,867,011 I67N probably damaging Het
Pyroxd1 A G 6: 142,357,456 K273R probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpusd1 A T 17: 25,730,378 H174L probably damaging Het
Ryr2 T C 13: 11,895,220 K94R probably benign Het
Scn2b A G 9: 45,118,030 R3G probably benign Het
Sf3b2 A T 19: 5,275,098 M782K possibly damaging Het
Skint7 A G 4: 111,984,876 probably null Het
Slc43a1 A G 2: 84,856,840 I319V possibly damaging Het
Snupn T A 9: 56,982,963 M356K probably damaging Het
Spata31d1a C A 13: 59,700,564 R1250M probably damaging Het
Sprr2h T C 3: 92,386,909 V21A unknown Het
Srpr A G 9: 35,215,995 T614A possibly damaging Het
Stk36 A T 1: 74,611,432 Q327L probably benign Het
Syne3 A G 12: 104,943,363 I738T probably benign Het
Tcea3 A T 4: 136,248,049 M1L probably damaging Het
Tead2 G T 7: 45,218,102 R85L probably damaging Het
Thap7 T C 16: 17,528,436 N228D possibly damaging Het
Trip11 T A 12: 101,898,895 E173V probably damaging Het
Ttc38 T A 15: 85,841,497 M187K possibly damaging Het
Vmn1r193 T A 13: 22,218,968 T285S possibly damaging Het
Vmn2r106 T C 17: 20,268,329 T603A probably damaging Het
Vps39 A T 2: 120,333,416 M355K probably damaging Het
Wnt5b G T 6: 119,446,512 L51I probably damaging Het
Xxylt1 A G 16: 31,007,808 Y230H probably benign Het
Other mutations in Npnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Npnt APN 3 132904657 critical splice donor site probably null
IGL01457:Npnt APN 3 132885982 missense probably damaging 1.00
IGL01954:Npnt APN 3 132909963 missense probably damaging 1.00
IGL01999:Npnt APN 3 132908399 missense probably damaging 1.00
IGL02012:Npnt APN 3 132908397 missense probably damaging 1.00
IGL02025:Npnt APN 3 132890762 critical splice donor site probably null
IGL02637:Npnt APN 3 132884510 missense possibly damaging 0.90
R0234:Npnt UTSW 3 132914414 missense possibly damaging 0.82
R0234:Npnt UTSW 3 132914414 missense possibly damaging 0.82
R1680:Npnt UTSW 3 132906802 missense probably benign 0.00
R1729:Npnt UTSW 3 132914397 nonsense probably null
R1773:Npnt UTSW 3 132904693 missense possibly damaging 0.62
R1980:Npnt UTSW 3 132948132 missense probably benign 0.04
R1982:Npnt UTSW 3 132948132 missense probably benign 0.04
R2338:Npnt UTSW 3 132891409 missense probably damaging 1.00
R3800:Npnt UTSW 3 132906763 missense probably damaging 1.00
R4739:Npnt UTSW 3 132904691 missense possibly damaging 0.93
R4790:Npnt UTSW 3 132890762 critical splice donor site probably benign
R5008:Npnt UTSW 3 132906457 missense probably damaging 1.00
R5446:Npnt UTSW 3 132908369 missense probably damaging 1.00
R5471:Npnt UTSW 3 132914387 missense probably benign 0.05
R5538:Npnt UTSW 3 132904963 missense probably damaging 1.00
R5673:Npnt UTSW 3 132917497 missense probably damaging 0.97
R5683:Npnt UTSW 3 132906840 splice site probably null
R5827:Npnt UTSW 3 132906775 missense possibly damaging 0.89
R5857:Npnt UTSW 3 132908349 missense probably damaging 1.00
R5910:Npnt UTSW 3 132906418 missense probably damaging 1.00
R6358:Npnt UTSW 3 132904718 missense probably benign 0.18
R6875:Npnt UTSW 3 132909910 missense probably damaging 1.00
R7025:Npnt UTSW 3 132908396 missense probably damaging 1.00
R7145:Npnt UTSW 3 132909931 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCTGATCACTGGCTGTAGG -3'
(R):5'- GAACGCGTACTTCCACTTCC -3'

Sequencing Primer
(F):5'- ATCACTGGCTGTAGGGACGC -3'
(R):5'- TTTTCAGGCAGGTCACCCGAC -3'
Posted On2018-02-27