Incidental Mutation 'R6208:Lpar1'
ID503250
Institutional Source Beutler Lab
Gene Symbol Lpar1
Ensembl Gene ENSMUSG00000038668
Gene Namelysophosphatidic acid receptor 1
SynonymsGpcr26, vzg-1, Kdt2, Edg2, LPA1
MMRRC Submission 044342-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6208 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location58435255-58553898 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 58504630 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 13 (Q13*)
Ref Sequence ENSEMBL: ENSMUSP00000121440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055018] [ENSMUST00000107571] [ENSMUST00000107574] [ENSMUST00000107575] [ENSMUST00000145361] [ENSMUST00000147354] [ENSMUST00000155170]
Predicted Effect probably null
Transcript: ENSMUST00000055018
AA Change: Q13*
SMART Domains Protein: ENSMUSP00000052581
Gene: ENSMUSG00000038668
AA Change: Q13*

DomainStartEndE-ValueType
Pfam:7tm_1 66 311 5.9e-39 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107571
AA Change: Q13*
SMART Domains Protein: ENSMUSP00000103197
Gene: ENSMUSG00000038668
AA Change: Q13*

DomainStartEndE-ValueType
Pfam:7tm_1 66 311 1.3e-41 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107574
AA Change: Q13*
SMART Domains Protein: ENSMUSP00000103200
Gene: ENSMUSG00000038668
AA Change: Q13*

DomainStartEndE-ValueType
Pfam:7tm_1 66 311 1.3e-41 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107575
AA Change: Q13*
SMART Domains Protein: ENSMUSP00000103201
Gene: ENSMUSG00000038668
AA Change: Q13*

DomainStartEndE-ValueType
Pfam:7tm_1 66 311 1.3e-41 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000145361
AA Change: Q13*
Predicted Effect probably null
Transcript: ENSMUST00000147354
AA Change: Q13*
Predicted Effect probably null
Transcript: ENSMUST00000155170
AA Change: Q13*
SMART Domains Protein: ENSMUSP00000121440
Gene: ENSMUSG00000038668
AA Change: Q13*

DomainStartEndE-ValueType
transmembrane domain 52 74 N/A INTRINSIC
Meta Mutation Damage Score 0.63 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The integral membrane protein encoded by this gene is a lysophosphatidic acid (LPA) receptor from a group known as EDG receptors. These receptors are members of the G protein-coupled receptor superfamily. Utilized by LPA for cell signaling, EDG receptors mediate diverse biologic functions, including proliferation, platelet aggregation, smooth muscle contraction, inhibition of neuroblastoma cell differentiation, chemotaxis, and tumor cell invasion. Two transcript variants encoding the same protein have been identified for this gene [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mutations cause partial peri- and postnatal lethality, growth defects, craniofacial anomalies, and wide set eyes. Additional phenotypes include altered brain 5-HT and amino acids, reduced prepulse inhibition, impaired suckling, and increased apoptosis in sciatic nerve Schwann cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A T 3: 32,711,894 I18F probably benign Het
Apol11a C T 15: 77,517,041 R243C probably damaging Het
Asap3 A G 4: 136,241,197 M687V probably benign Het
Axdnd1 C T 1: 156,392,856 probably benign Het
Baz2b A G 2: 59,924,806 F1026S probably damaging Het
Bsg T C 10: 79,708,838 L70P probably damaging Het
Col10a1 A G 10: 34,394,586 N185D possibly damaging Het
Col6a2 T A 10: 76,615,057 N50I possibly damaging Het
Cux2 G A 5: 121,860,822 P1352S possibly damaging Het
Defa25 A G 8: 21,085,181 probably null Het
Emc1 G T 4: 139,354,271 R70L probably damaging Het
Fat1 T C 8: 45,027,613 F3028S probably damaging Het
Fhit T C 14: 9,573,435 E205G probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm20830 T G Y: 6,916,792 E109A probably benign Homo
Grm1 A T 10: 10,719,946 F646Y probably damaging Het
Hp1bp3 A G 4: 138,217,170 probably benign Het
Lce1d G A 3: 92,686,005 P34S unknown Het
Lrrc61 C T 6: 48,568,905 R221* probably null Het
Map2 A G 1: 66,431,590 N328D probably damaging Het
Mndal T A 1: 173,857,422 D527V possibly damaging Het
Mycbp2 T G 14: 103,295,228 N430T probably benign Het
Myo1e A G 9: 70,376,605 Y861C probably damaging Het
Nav2 A G 7: 49,564,103 T1622A probably damaging Het
Nom1 A T 5: 29,449,619 H773L possibly damaging Het
Npc2 G T 12: 84,757,145 P144Q probably damaging Het
Npnt A G 3: 132,950,013 probably benign Het
Nxpe4 A T 9: 48,393,378 Y255F probably benign Het
Obscn G A 11: 59,067,648 A3769V possibly damaging Het
Optc T C 1: 133,904,999 D121G probably damaging Het
Pard6a T C 8: 105,702,234 F26L probably damaging Het
Pcdhga4 T A 18: 37,686,709 I437N probably damaging Het
Phf12 G T 11: 78,023,591 V71F probably damaging Het
Phf21b T A 15: 84,795,116 S282C probably damaging Het
Pou5f1 T C 17: 35,510,460 F323S possibly damaging Het
Psmd5 A T 2: 34,867,011 I67N probably damaging Het
Pyroxd1 A G 6: 142,357,456 K273R probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpusd1 A T 17: 25,730,378 H174L probably damaging Het
Ryr2 T C 13: 11,895,220 K94R probably benign Het
Scn2b A G 9: 45,118,030 R3G probably benign Het
Sf3b2 A T 19: 5,275,098 M782K possibly damaging Het
Skint7 A G 4: 111,984,876 probably null Het
Slc43a1 A G 2: 84,856,840 I319V possibly damaging Het
Snupn T A 9: 56,982,963 M356K probably damaging Het
Spata31d1a C A 13: 59,700,564 R1250M probably damaging Het
Sprr2h T C 3: 92,386,909 V21A unknown Het
Srpr A G 9: 35,215,995 T614A possibly damaging Het
Stk36 A T 1: 74,611,432 Q327L probably benign Het
Syne3 A G 12: 104,943,363 I738T probably benign Het
Tcea3 A T 4: 136,248,049 M1L probably damaging Het
Tead2 G T 7: 45,218,102 R85L probably damaging Het
Thap7 T C 16: 17,528,436 N228D possibly damaging Het
Trip11 T A 12: 101,898,895 E173V probably damaging Het
Ttc38 T A 15: 85,841,497 M187K possibly damaging Het
Vmn1r193 T A 13: 22,218,968 T285S possibly damaging Het
Vmn2r106 T C 17: 20,268,329 T603A probably damaging Het
Vps39 A T 2: 120,333,416 M355K probably damaging Het
Wnt5b G T 6: 119,446,512 L51I probably damaging Het
Xxylt1 A G 16: 31,007,808 Y230H probably benign Het
Other mutations in Lpar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01735:Lpar1 APN 4 58437407 missense probably damaging 1.00
bijou UTSW 4 58487155 missense possibly damaging 0.81
frenzied UTSW 4 58437346 missense possibly damaging 0.94
helper UTSW 4 58486875 missense possibly damaging 0.95
R0403:Lpar1 UTSW 4 58487191 missense probably damaging 1.00
R1793:Lpar1 UTSW 4 58486798 nonsense probably null
R2312:Lpar1 UTSW 4 58487168 nonsense probably null
R4279:Lpar1 UTSW 4 58487115 missense possibly damaging 0.73
R4762:Lpar1 UTSW 4 58437346 missense possibly damaging 0.94
R5391:Lpar1 UTSW 4 58486902 missense probably damaging 1.00
R5500:Lpar1 UTSW 4 58486573 missense probably benign 0.26
R5619:Lpar1 UTSW 4 58487155 missense possibly damaging 0.81
R6304:Lpar1 UTSW 4 58487013 missense probably damaging 1.00
R6464:Lpar1 UTSW 4 58486875 missense possibly damaging 0.95
R6593:Lpar1 UTSW 4 58486605 missense probably damaging 1.00
R7267:Lpar1 UTSW 4 58486857 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGCCAGCTCATTTTCTCAGC -3'
(R):5'- AGATGGTGACCTTTCCTTGCC -3'

Sequencing Primer
(F):5'- TCTCAGCTGCTTCCCAAACAC -3'
(R):5'- ACTCATTCTGGGATTCCTTGTG -3'
Posted On2018-02-27