Incidental Mutation 'R6208:Asap3'
ID503252
Institutional Source Beutler Lab
Gene Symbol Asap3
Ensembl Gene ENSMUSG00000036995
Gene NameArfGAP with SH3 domain, ankyrin repeat and PH domain 3
SynonymsUPLC1, 9430088F20Rik, Ddefl1
MMRRC Submission 044342-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R6208 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location136206365-136245216 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136241197 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 687 (M687V)
Ref Sequence ENSEMBL: ENSMUSP00000041899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047526]
Predicted Effect probably benign
Transcript: ENSMUST00000047526
AA Change: M687V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041899
Gene: ENSMUSG00000036995
AA Change: M687V

DomainStartEndE-ValueType
low complexity region 22 29 N/A INTRINSIC
Pfam:BAR_3 32 264 5.5e-20 PFAM
PH 303 396 5.61e-17 SMART
ArfGap 425 547 8.33e-31 SMART
ANK 584 616 4.86e1 SMART
ANK 620 649 3.06e-5 SMART
low complexity region 794 806 N/A INTRINSIC
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of ADP-ribosylation factor(Arf) GTPase-activating proteins that contain additional ankyrin repeat and pleckstrin homology domains. The Arf GAP domain of this protein catalyzes the hydrolysis of GTP bound to Arf proteins. The encoded protein promotes cell differentiation and migration and has been implicated in cancer cell invasion. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A T 3: 32,711,894 I18F probably benign Het
Apol11a C T 15: 77,517,041 R243C probably damaging Het
Axdnd1 C T 1: 156,392,856 probably benign Het
Baz2b A G 2: 59,924,806 F1026S probably damaging Het
Bsg T C 10: 79,708,838 L70P probably damaging Het
Col10a1 A G 10: 34,394,586 N185D possibly damaging Het
Col6a2 T A 10: 76,615,057 N50I possibly damaging Het
Cux2 G A 5: 121,860,822 P1352S possibly damaging Het
Defa25 A G 8: 21,085,181 probably null Het
Emc1 G T 4: 139,354,271 R70L probably damaging Het
Fat1 T C 8: 45,027,613 F3028S probably damaging Het
Fhit T C 14: 9,573,435 E205G probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm20830 T G Y: 6,916,792 E109A probably benign Homo
Grm1 A T 10: 10,719,946 F646Y probably damaging Het
Hp1bp3 A G 4: 138,217,170 probably benign Het
Lce1d G A 3: 92,686,005 P34S unknown Het
Lpar1 G A 4: 58,504,630 Q13* probably null Het
Lrrc61 C T 6: 48,568,905 R221* probably null Het
Map2 A G 1: 66,431,590 N328D probably damaging Het
Mndal T A 1: 173,857,422 D527V possibly damaging Het
Mycbp2 T G 14: 103,295,228 N430T probably benign Het
Myo1e A G 9: 70,376,605 Y861C probably damaging Het
Nav2 A G 7: 49,564,103 T1622A probably damaging Het
Nom1 A T 5: 29,449,619 H773L possibly damaging Het
Npc2 G T 12: 84,757,145 P144Q probably damaging Het
Npnt A G 3: 132,950,013 probably benign Het
Nxpe4 A T 9: 48,393,378 Y255F probably benign Het
Obscn G A 11: 59,067,648 A3769V possibly damaging Het
Optc T C 1: 133,904,999 D121G probably damaging Het
Pard6a T C 8: 105,702,234 F26L probably damaging Het
Pcdhga4 T A 18: 37,686,709 I437N probably damaging Het
Phf12 G T 11: 78,023,591 V71F probably damaging Het
Phf21b T A 15: 84,795,116 S282C probably damaging Het
Pou5f1 T C 17: 35,510,460 F323S possibly damaging Het
Psmd5 A T 2: 34,867,011 I67N probably damaging Het
Pyroxd1 A G 6: 142,357,456 K273R probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpusd1 A T 17: 25,730,378 H174L probably damaging Het
Ryr2 T C 13: 11,895,220 K94R probably benign Het
Scn2b A G 9: 45,118,030 R3G probably benign Het
Sf3b2 A T 19: 5,275,098 M782K possibly damaging Het
Skint7 A G 4: 111,984,876 probably null Het
Slc43a1 A G 2: 84,856,840 I319V possibly damaging Het
Snupn T A 9: 56,982,963 M356K probably damaging Het
Spata31d1a C A 13: 59,700,564 R1250M probably damaging Het
Sprr2h T C 3: 92,386,909 V21A unknown Het
Srpr A G 9: 35,215,995 T614A possibly damaging Het
Stk36 A T 1: 74,611,432 Q327L probably benign Het
Syne3 A G 12: 104,943,363 I738T probably benign Het
Tcea3 A T 4: 136,248,049 M1L probably damaging Het
Tead2 G T 7: 45,218,102 R85L probably damaging Het
Thap7 T C 16: 17,528,436 N228D possibly damaging Het
Trip11 T A 12: 101,898,895 E173V probably damaging Het
Ttc38 T A 15: 85,841,497 M187K possibly damaging Het
Vmn1r193 T A 13: 22,218,968 T285S possibly damaging Het
Vmn2r106 T C 17: 20,268,329 T603A probably damaging Het
Vps39 A T 2: 120,333,416 M355K probably damaging Het
Wnt5b G T 6: 119,446,512 L51I probably damaging Het
Xxylt1 A G 16: 31,007,808 Y230H probably benign Het
Other mutations in Asap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Asap3 APN 4 136206568 missense probably damaging 1.00
IGL01865:Asap3 APN 4 136236404 missense probably damaging 1.00
IGL02045:Asap3 APN 4 136227441 missense probably benign 0.01
IGL02105:Asap3 APN 4 136228474 critical splice donor site probably null
IGL02135:Asap3 APN 4 136241153 critical splice acceptor site probably null
IGL02484:Asap3 APN 4 136229457 splice site probably benign
IGL02524:Asap3 APN 4 136238616 missense probably damaging 1.00
IGL02881:Asap3 APN 4 136239237 missense probably benign 0.00
R0128:Asap3 UTSW 4 136234604 missense probably damaging 0.99
R0883:Asap3 UTSW 4 136234325 splice site probably benign
R0903:Asap3 UTSW 4 136238376 missense probably benign
R1073:Asap3 UTSW 4 136236431 missense probably damaging 1.00
R1498:Asap3 UTSW 4 136239194 missense probably benign
R1951:Asap3 UTSW 4 136227456 nonsense probably null
R1953:Asap3 UTSW 4 136227456 nonsense probably null
R3703:Asap3 UTSW 4 136241241 small insertion probably benign
R3704:Asap3 UTSW 4 136241241 small insertion probably benign
R3705:Asap3 UTSW 4 136241241 small insertion probably benign
R3754:Asap3 UTSW 4 136229455 splice site probably null
R3773:Asap3 UTSW 4 136227575 missense probably benign 0.22
R3911:Asap3 UTSW 4 136229457 splice site probably benign
R4570:Asap3 UTSW 4 136240185 missense probably damaging 0.99
R4879:Asap3 UTSW 4 136242664 missense probably benign 0.04
R5394:Asap3 UTSW 4 136241259 missense probably benign 0.00
R5497:Asap3 UTSW 4 136239222 missense probably benign 0.13
R5914:Asap3 UTSW 4 136241409 missense probably benign 0.18
R6214:Asap3 UTSW 4 136241425 missense possibly damaging 0.80
R6495:Asap3 UTSW 4 136228479 splice site probably null
R6577:Asap3 UTSW 4 136238230 splice site probably null
R6823:Asap3 UTSW 4 136227572 missense possibly damaging 0.95
R7081:Asap3 UTSW 4 136241570 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGAGACAGCCCTGGACATAG -3'
(R):5'- AACGGTCTCATAGGTCTTGTTGC -3'

Sequencing Primer
(F):5'- GCCCTGGACATAGCCAGAAAC -3'
(R):5'- TGATGTCCAGCCTCACACTAC -3'
Posted On2018-02-27