Incidental Mutation 'R6208:Wnt5b'
ID503259
Institutional Source Beutler Lab
Gene Symbol Wnt5b
Ensembl Gene ENSMUSG00000030170
Gene Namewingless-type MMTV integration site family, member 5B
SynonymsWnt-5b
MMRRC Submission 044342-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6208 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location119432531-119544347 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 119446512 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 51 (L51I)
Ref Sequence ENSEMBL: ENSMUSP00000137065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117171] [ENSMUST00000118120] [ENSMUST00000119369] [ENSMUST00000178696]
Predicted Effect probably damaging
Transcript: ENSMUST00000117171
AA Change: L51I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113188
Gene: ENSMUSG00000030170
AA Change: L51I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
WNT1 50 359 3.47e-215 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118120
AA Change: L13I

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112819
Gene: ENSMUSG00000030170
AA Change: L13I

DomainStartEndE-ValueType
WNT1 12 321 3.47e-215 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119369
AA Change: L64I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112448
Gene: ENSMUSG00000030170
AA Change: L64I

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
WNT1 63 372 3.47e-215 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178696
AA Change: L51I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137065
Gene: ENSMUSG00000030170
AA Change: L51I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
WNT1 50 359 3.47e-215 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 94% and 80% amino acid identity to the mouse Wnt5b protein and the human WNT5A protein, respectively. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal numbers of thoracic motor neurons and proportions of motor columnar subtypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A T 3: 32,711,894 I18F probably benign Het
Apol11a C T 15: 77,517,041 R243C probably damaging Het
Asap3 A G 4: 136,241,197 M687V probably benign Het
Axdnd1 C T 1: 156,392,856 probably benign Het
Baz2b A G 2: 59,924,806 F1026S probably damaging Het
Bsg T C 10: 79,708,838 L70P probably damaging Het
Col10a1 A G 10: 34,394,586 N185D possibly damaging Het
Col6a2 T A 10: 76,615,057 N50I possibly damaging Het
Cux2 G A 5: 121,860,822 P1352S possibly damaging Het
Defa25 A G 8: 21,085,181 probably null Het
Emc1 G T 4: 139,354,271 R70L probably damaging Het
Fat1 T C 8: 45,027,613 F3028S probably damaging Het
Fhit T C 14: 9,573,435 E205G probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm20830 T G Y: 6,916,792 E109A probably benign Homo
Grm1 A T 10: 10,719,946 F646Y probably damaging Het
Hp1bp3 A G 4: 138,217,170 probably benign Het
Lce1d G A 3: 92,686,005 P34S unknown Het
Lpar1 G A 4: 58,504,630 Q13* probably null Het
Lrrc61 C T 6: 48,568,905 R221* probably null Het
Map2 A G 1: 66,431,590 N328D probably damaging Het
Mndal T A 1: 173,857,422 D527V possibly damaging Het
Mycbp2 T G 14: 103,295,228 N430T probably benign Het
Myo1e A G 9: 70,376,605 Y861C probably damaging Het
Nav2 A G 7: 49,564,103 T1622A probably damaging Het
Nom1 A T 5: 29,449,619 H773L possibly damaging Het
Npc2 G T 12: 84,757,145 P144Q probably damaging Het
Npnt A G 3: 132,950,013 probably benign Het
Nxpe4 A T 9: 48,393,378 Y255F probably benign Het
Obscn G A 11: 59,067,648 A3769V possibly damaging Het
Optc T C 1: 133,904,999 D121G probably damaging Het
Pard6a T C 8: 105,702,234 F26L probably damaging Het
Pcdhga4 T A 18: 37,686,709 I437N probably damaging Het
Phf12 G T 11: 78,023,591 V71F probably damaging Het
Phf21b T A 15: 84,795,116 S282C probably damaging Het
Pou5f1 T C 17: 35,510,460 F323S possibly damaging Het
Psmd5 A T 2: 34,867,011 I67N probably damaging Het
Pyroxd1 A G 6: 142,357,456 K273R probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpusd1 A T 17: 25,730,378 H174L probably damaging Het
Ryr2 T C 13: 11,895,220 K94R probably benign Het
Scn2b A G 9: 45,118,030 R3G probably benign Het
Sf3b2 A T 19: 5,275,098 M782K possibly damaging Het
Skint7 A G 4: 111,984,876 probably null Het
Slc43a1 A G 2: 84,856,840 I319V possibly damaging Het
Snupn T A 9: 56,982,963 M356K probably damaging Het
Spata31d1a C A 13: 59,700,564 R1250M probably damaging Het
Sprr2h T C 3: 92,386,909 V21A unknown Het
Srpr A G 9: 35,215,995 T614A possibly damaging Het
Stk36 A T 1: 74,611,432 Q327L probably benign Het
Syne3 A G 12: 104,943,363 I738T probably benign Het
Tcea3 A T 4: 136,248,049 M1L probably damaging Het
Tead2 G T 7: 45,218,102 R85L probably damaging Het
Thap7 T C 16: 17,528,436 N228D possibly damaging Het
Trip11 T A 12: 101,898,895 E173V probably damaging Het
Ttc38 T A 15: 85,841,497 M187K possibly damaging Het
Vmn1r193 T A 13: 22,218,968 T285S possibly damaging Het
Vmn2r106 T C 17: 20,268,329 T603A probably damaging Het
Vps39 A T 2: 120,333,416 M355K probably damaging Het
Xxylt1 A G 16: 31,007,808 Y230H probably benign Het
Other mutations in Wnt5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01590:Wnt5b APN 6 119440554 missense possibly damaging 0.70
IGL01822:Wnt5b APN 6 119433472 missense probably damaging 1.00
Luftmensch UTSW 6 119433852 missense probably damaging 0.97
R0557:Wnt5b UTSW 6 119433818 missense probably damaging 1.00
R0732:Wnt5b UTSW 6 119446582 nonsense probably null
R1472:Wnt5b UTSW 6 119433481 missense probably damaging 1.00
R1673:Wnt5b UTSW 6 119446354 missense probably benign 0.19
R4202:Wnt5b UTSW 6 119440311 missense probably damaging 1.00
R5100:Wnt5b UTSW 6 119440488 missense probably benign 0.20
R5264:Wnt5b UTSW 6 119433852 missense probably damaging 0.97
R5393:Wnt5b UTSW 6 119440433 missense probably damaging 1.00
R5394:Wnt5b UTSW 6 119440322 missense probably damaging 0.98
R5482:Wnt5b UTSW 6 119446431 missense probably benign 0.19
R5741:Wnt5b UTSW 6 119433729 missense probably damaging 1.00
R5902:Wnt5b UTSW 6 119448238 missense probably benign 0.00
R6005:Wnt5b UTSW 6 119433654 missense probably benign 0.04
R6061:Wnt5b UTSW 6 119433642 missense probably damaging 0.98
R6405:Wnt5b UTSW 6 119433496 missense probably benign 0.06
R6478:Wnt5b UTSW 6 119433790 missense probably damaging 1.00
R6482:Wnt5b UTSW 6 119433612 missense possibly damaging 0.88
R7047:Wnt5b UTSW 6 119448256 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GCTATCTATCGATGCACCAGG -3'
(R):5'- TTTATGGAGAACGTCGCAGAG -3'

Sequencing Primer
(F):5'- ACAGGTCCAGAGGCCTCTTAC -3'
(R):5'- TCGCAGAGGGGGTGGAG -3'
Posted On2018-02-27