Incidental Mutation 'R6208:Thap7'
ID503290
Institutional Source Beutler Lab
Gene Symbol Thap7
Ensembl Gene ENSMUSG00000022760
Gene NameTHAP domain containing 7
Synonyms
MMRRC Submission 044342-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.819) question?
Stock #R6208 (G1)
Quality Score220.009
Status Validated
Chromosome16
Chromosomal Location17527982-17531136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17528436 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 228 (N228D)
Ref Sequence ENSEMBL: ENSMUSP00000156168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023444] [ENSMUST00000100125] [ENSMUST00000231288] [ENSMUST00000231292] [ENSMUST00000231307] [ENSMUST00000231424] [ENSMUST00000231548] [ENSMUST00000231994] [ENSMUST00000232041] [ENSMUST00000232114]
Predicted Effect probably benign
Transcript: ENSMUST00000023444
SMART Domains Protein: ENSMUSP00000023444
Gene: ENSMUSG00000022761

DomainStartEndE-ValueType
Pfam:Kelch_6 64 103 1.1e-7 PFAM
Pfam:Kelch_1 64 105 1.7e-7 PFAM
Pfam:Kelch_4 64 113 4.7e-10 PFAM
Pfam:Kelch_3 74 123 3.1e-10 PFAM
Pfam:Kelch_5 111 152 7.2e-9 PFAM
Pfam:Kelch_1 114 161 2.8e-7 PFAM
Pfam:Kelch_2 114 163 1e-7 PFAM
Pfam:Kelch_4 114 170 1.9e-6 PFAM
Pfam:Kelch_3 124 180 9.1e-9 PFAM
Pfam:Kelch_4 171 224 6.1e-6 PFAM
Pfam:Kelch_3 181 232 6e-7 PFAM
Pfam:Kelch_1 224 267 1e-6 PFAM
Pfam:Kelch_4 225 278 6.2e-6 PFAM
Pfam:Kelch_3 234 289 2.2e-8 PFAM
Pfam:Kelch_1 280 325 7.7e-10 PFAM
Pfam:Kelch_2 280 325 4.3e-7 PFAM
Pfam:Kelch_6 280 325 9.6e-9 PFAM
Pfam:Kelch_4 280 329 2.5e-8 PFAM
BTB 440 571 4.16e-4 SMART
BTB 664 765 2.95e-18 SMART
low complexity region 808 821 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100125
AA Change: N228D

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097701
Gene: ENSMUSG00000022760
AA Change: N228D

DomainStartEndE-ValueType
THAP 3 99 5e-20 SMART
DM3 25 98 4.22e-20 SMART
low complexity region 118 130 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
coiled coil region 239 296 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231230
Predicted Effect probably benign
Transcript: ENSMUST00000231288
Predicted Effect probably benign
Transcript: ENSMUST00000231292
Predicted Effect probably benign
Transcript: ENSMUST00000231307
Predicted Effect probably benign
Transcript: ENSMUST00000231424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231446
Predicted Effect possibly damaging
Transcript: ENSMUST00000231548
AA Change: N228D

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231623
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231746
Predicted Effect probably benign
Transcript: ENSMUST00000231994
Predicted Effect possibly damaging
Transcript: ENSMUST00000232041
AA Change: N129D

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232046
Predicted Effect probably benign
Transcript: ENSMUST00000232114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232438
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A T 3: 32,711,894 I18F probably benign Het
Apol11a C T 15: 77,517,041 R243C probably damaging Het
Asap3 A G 4: 136,241,197 M687V probably benign Het
Axdnd1 C T 1: 156,392,856 probably benign Het
Baz2b A G 2: 59,924,806 F1026S probably damaging Het
Bsg T C 10: 79,708,838 L70P probably damaging Het
Col10a1 A G 10: 34,394,586 N185D possibly damaging Het
Col6a2 T A 10: 76,615,057 N50I possibly damaging Het
Cux2 G A 5: 121,860,822 P1352S possibly damaging Het
Defa25 A G 8: 21,085,181 probably null Het
Emc1 G T 4: 139,354,271 R70L probably damaging Het
Fat1 T C 8: 45,027,613 F3028S probably damaging Het
Fhit T C 14: 9,573,435 E205G probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm20830 T G Y: 6,916,792 E109A probably benign Homo
Grm1 A T 10: 10,719,946 F646Y probably damaging Het
Hp1bp3 A G 4: 138,217,170 probably benign Het
Lce1d G A 3: 92,686,005 P34S unknown Het
Lpar1 G A 4: 58,504,630 Q13* probably null Het
Lrrc61 C T 6: 48,568,905 R221* probably null Het
Map2 A G 1: 66,431,590 N328D probably damaging Het
Mndal T A 1: 173,857,422 D527V possibly damaging Het
Mycbp2 T G 14: 103,295,228 N430T probably benign Het
Myo1e A G 9: 70,376,605 Y861C probably damaging Het
Nav2 A G 7: 49,564,103 T1622A probably damaging Het
Nom1 A T 5: 29,449,619 H773L possibly damaging Het
Npc2 G T 12: 84,757,145 P144Q probably damaging Het
Npnt A G 3: 132,950,013 probably benign Het
Nxpe4 A T 9: 48,393,378 Y255F probably benign Het
Obscn G A 11: 59,067,648 A3769V possibly damaging Het
Optc T C 1: 133,904,999 D121G probably damaging Het
Pard6a T C 8: 105,702,234 F26L probably damaging Het
Pcdhga4 T A 18: 37,686,709 I437N probably damaging Het
Phf12 G T 11: 78,023,591 V71F probably damaging Het
Phf21b T A 15: 84,795,116 S282C probably damaging Het
Pou5f1 T C 17: 35,510,460 F323S possibly damaging Het
Psmd5 A T 2: 34,867,011 I67N probably damaging Het
Pyroxd1 A G 6: 142,357,456 K273R probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpusd1 A T 17: 25,730,378 H174L probably damaging Het
Ryr2 T C 13: 11,895,220 K94R probably benign Het
Scn2b A G 9: 45,118,030 R3G probably benign Het
Sf3b2 A T 19: 5,275,098 M782K possibly damaging Het
Skint7 A G 4: 111,984,876 probably null Het
Slc43a1 A G 2: 84,856,840 I319V possibly damaging Het
Snupn T A 9: 56,982,963 M356K probably damaging Het
Spata31d1a C A 13: 59,700,564 R1250M probably damaging Het
Sprr2h T C 3: 92,386,909 V21A unknown Het
Srpr A G 9: 35,215,995 T614A possibly damaging Het
Stk36 A T 1: 74,611,432 Q327L probably benign Het
Syne3 A G 12: 104,943,363 I738T probably benign Het
Tcea3 A T 4: 136,248,049 M1L probably damaging Het
Tead2 G T 7: 45,218,102 R85L probably damaging Het
Trip11 T A 12: 101,898,895 E173V probably damaging Het
Ttc38 T A 15: 85,841,497 M187K possibly damaging Het
Vmn1r193 T A 13: 22,218,968 T285S possibly damaging Het
Vmn2r106 T C 17: 20,268,329 T603A probably damaging Het
Vps39 A T 2: 120,333,416 M355K probably damaging Het
Wnt5b G T 6: 119,446,512 L51I probably damaging Het
Xxylt1 A G 16: 31,007,808 Y230H probably benign Het
Other mutations in Thap7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01519:Thap7 APN 16 17528745 splice site probably benign
R1686:Thap7 UTSW 16 17528712 missense probably damaging 1.00
R1708:Thap7 UTSW 16 17528950 missense probably benign 0.00
R5965:Thap7 UTSW 16 17530747 intron probably benign
Predicted Primers PCR Primer
(F):5'- GTACATGGTCCTTCAGAGTCTGG -3'
(R):5'- TGTGGAAGAAGCCTCAGCAC -3'

Sequencing Primer
(F):5'- TTCAGAGTCTGGCGGGCATC -3'
(R):5'- TGGACCCTGGCCTTAACAG -3'
Posted On2018-02-27