Incidental Mutation 'R6209:Il19'
ID503301
Institutional Source Beutler Lab
Gene Symbol Il19
Ensembl Gene ENSMUSG00000016524
Gene Nameinterleukin 19
Synonyms
MMRRC Submission 044343-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R6209 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location130932656-130940115 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 130939115 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 43 (E43K)
Ref Sequence ENSEMBL: ENSMUSP00000139406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016668] [ENSMUST00000112465] [ENSMUST00000187410] [ENSMUST00000187916]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016668
AA Change: E43K

PolyPhen 2 Score 0.677 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000016668
Gene: ENSMUSG00000016524
AA Change: E43K

DomainStartEndE-ValueType
IL10 30 171 1.64e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112465
AA Change: E43K

PolyPhen 2 Score 0.677 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108084
Gene: ENSMUSG00000016524
AA Change: E43K

DomainStartEndE-ValueType
IL10 30 171 1.64e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000187410
AA Change: E43K

PolyPhen 2 Score 0.677 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139406
Gene: ENSMUSG00000016524
AA Change: E43K

DomainStartEndE-ValueType
IL10 30 171 1.64e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187916
SMART Domains Protein: ENSMUSP00000141175
Gene: ENSMUSG00000016524

DomainStartEndE-ValueType
SCOP:d1lqsl_ 1 91 8e-26 SMART
PDB:1N1F|A 1 95 6e-45 PDB
Blast:IL10 1 96 5e-65 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that belongs to the IL10 cytokine subfamily. This cytokine is found to be preferentially expressed in monocytes. It can bind the IL20 receptor complex and lead to the activation of the signal transducer and activator of transcription 3 (STAT3). A similar cytokine in mouse is reported to up-regulate the expression of IL6 and TNF-alpha and induce apoptosis, which suggests a role of this cytokine in inflammatory responses. Alternatively spliced transcript variants encoding the distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit interleukin-23 (IL-23)-dependent epidermal hyperplasia. Mice homozygous for a different knock-out allele exhibit increased susceptibility to induced colitis with reduced B cell infiltration in chronic colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 T A 1: 38,193,589 M990L probably benign Het
Agl A T 3: 116,785,196 Y429* probably null Het
Ahnak A T 19: 9,012,566 K3738M probably damaging Het
AI481877 A G 4: 59,043,869 *1482R probably null Het
Amn G T 12: 111,275,411 V304L probably damaging Het
Ap3s1 G A 18: 46,779,251 V113I probably benign Het
Arhgef28 A T 13: 97,929,409 probably null Het
Atad2 A G 15: 58,118,415 S18P probably damaging Het
C4b T A 17: 34,741,087 E305V possibly damaging Het
Caskin1 T C 17: 24,507,121 S1401P possibly damaging Het
Cblc A T 7: 19,785,305 V366D possibly damaging Het
Ccdc129 T A 6: 55,874,321 I62N probably damaging Het
Cdk17 A T 10: 93,208,231 T11S probably benign Het
Cenpc1 A G 5: 86,033,650 S619P probably benign Het
Clec4d T G 6: 123,270,529 probably null Het
Disp2 T C 2: 118,786,921 L132P probably damaging Het
Dync2h1 T C 9: 7,165,677 K528R probably benign Het
Fbxw26 A G 9: 109,717,965 I464T possibly damaging Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gabbr2 A G 4: 46,804,069 V262A probably damaging Het
Galnt17 T A 5: 131,081,596 M302L probably benign Het
Gm5096 C T 18: 87,757,217 A288V probably damaging Het
Gpn3 T C 5: 122,382,112 I243T probably benign Het
Gpr160 T C 3: 30,895,992 V71A possibly damaging Het
Gramd1b G T 9: 40,333,650 A154D probably damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
H60b C A 10: 22,287,144 T206N probably benign Het
Hydin A T 8: 110,593,802 I4493F probably benign Het
Ints2 A G 11: 86,225,058 Y782H probably damaging Het
Jph1 C A 1: 17,097,586 D7Y probably damaging Het
Lipo2 T C 19: 33,749,452 I62V probably damaging Het
Map7 G A 10: 20,276,280 probably null Het
Matk T G 10: 81,259,588 W81G probably damaging Het
Matn4 T C 2: 164,400,815 Y121C probably damaging Het
Mical2 G A 7: 112,324,086 probably null Het
Miga2 T G 2: 30,381,662 Y399D probably damaging Het
Mocos A T 18: 24,666,615 E302V probably benign Het
Mrpl11 C T 19: 4,964,715 A172V probably damaging Het
Mrpl48 A C 7: 100,559,794 Y108D probably damaging Het
Mtr A G 13: 12,190,392 S1061P probably benign Het
Myh11 T A 16: 14,208,291 K1309* probably null Het
Myom2 G A 8: 15,104,173 V704I possibly damaging Het
Nars2 A G 7: 97,057,521 H413R probably benign Het
Nckap1 A G 2: 80,525,602 L619P probably damaging Het
Notch1 T C 2: 26,472,805 N983S probably damaging Het
Nup210 A G 6: 91,025,355 V717A probably benign Het
P4ha3 G T 7: 100,317,085 G479V probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Phf11a A G 14: 59,287,579 S59P probably damaging Het
Phyhip G A 14: 70,463,358 S95N probably benign Het
Ppat A G 5: 76,918,146 V375A probably benign Het
Prkdc A G 16: 15,790,592 E3086G probably damaging Het
Psg22 A G 7: 18,719,674 E98G probably damaging Het
Rabgap1 A T 2: 37,563,598 K1013* probably null Het
Retreg3 C T 11: 101,119,700 G27D probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sema6a A T 18: 47,298,302 probably null Het
Sept10 T C 10: 59,170,848 E349G probably damaging Het
Serpina1c A G 12: 103,897,170 V257A probably damaging Het
Sgpp2 T A 1: 78,390,482 M84K probably damaging Het
Skint11 A G 4: 114,244,710 S116G possibly damaging Het
Slc2a5 G A 4: 150,143,100 V459I probably benign Het
Smarca2 T G 19: 26,771,004 Y126* probably null Het
Stab2 T G 10: 86,923,003 N1024H possibly damaging Het
Svep1 A C 4: 58,128,869 F609L probably benign Het
Tbc1d2 G A 4: 46,614,068 T671I probably damaging Het
Thoc5 T C 11: 4,905,697 I82T probably damaging Het
Tmem173 A T 18: 35,736,102 I178N probably damaging Het
Tmem213 G T 6: 38,115,582 C83F probably damaging Het
Topaz1 G A 9: 122,750,505 D827N possibly damaging Het
Trappc10 C A 10: 78,214,812 G265V possibly damaging Het
Ttn A G 2: 76,709,464 S26066P probably damaging Het
Zfp292 G T 4: 34,809,442 Q1201K probably benign Het
Zfp354a T A 11: 51,060,988 probably null Het
Zfp418 T C 7: 7,182,097 V353A possibly damaging Het
Zfp444 G A 7: 6,189,949 probably benign Het
Zfp503 C A 14: 21,985,710 Q379H probably damaging Het
Zfp804a A G 2: 82,258,118 K764E probably damaging Het
Other mutations in Il19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Il19 APN 1 130935055 splice site probably benign
R1969:Il19 UTSW 1 130939156 missense probably damaging 1.00
R2064:Il19 UTSW 1 130939117 missense probably benign
R2851:Il19 UTSW 1 130935957 missense possibly damaging 0.73
R3977:Il19 UTSW 1 130936033 missense probably damaging 1.00
R4290:Il19 UTSW 1 130935013 missense possibly damaging 0.80
R4857:Il19 UTSW 1 130935946 missense probably damaging 1.00
R6016:Il19 UTSW 1 130935981 missense probably damaging 1.00
R7113:Il19 UTSW 1 130934995 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CGATTCTTAGCACAAGAGACAC -3'
(R):5'- TCTCTGCAGTCTAGGTGGAC -3'

Sequencing Primer
(F):5'- CAAATGGTACCTTAATGCTCCTGAGG -3'
(R):5'- CTAGGTGGACAGCTGACTTTCAC -3'
Posted On2018-02-27