Incidental Mutation 'R6209:Ccdc129'
ID503326
Institutional Source Beutler Lab
Gene Symbol Ccdc129
Ensembl Gene ENSMUSG00000037973
Gene Namecoiled-coil domain containing 129
SynonymsD530004J12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.023) question?
Stock #R6209 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location55836895-55978735 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55874321 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 62 (I62N)
Ref Sequence ENSEMBL: ENSMUSP00000045332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044729]
Predicted Effect probably damaging
Transcript: ENSMUST00000044729
AA Change: I62N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045332
Gene: ENSMUSG00000037973
AA Change: I62N

DomainStartEndE-ValueType
KRAP_IP3R_bind 112 264 2.99e-82 SMART
low complexity region 326 334 N/A INTRINSIC
low complexity region 432 442 N/A INTRINSIC
low complexity region 477 496 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
Pfam:SSFA2_C 806 916 3e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 T A 1: 38,193,589 M990L probably benign Het
Agl A T 3: 116,785,196 Y429* probably null Het
Ahnak A T 19: 9,012,566 K3738M probably damaging Het
AI481877 A G 4: 59,043,869 *1482R probably null Het
Amn G T 12: 111,275,411 V304L probably damaging Het
Ap3s1 G A 18: 46,779,251 V113I probably benign Het
Arhgef28 A T 13: 97,929,409 probably null Het
Atad2 A G 15: 58,118,415 S18P probably damaging Het
C4b T A 17: 34,741,087 E305V possibly damaging Het
Caskin1 T C 17: 24,507,121 S1401P possibly damaging Het
Cblc A T 7: 19,785,305 V366D possibly damaging Het
Cdk17 A T 10: 93,208,231 T11S probably benign Het
Cenpc1 A G 5: 86,033,650 S619P probably benign Het
Clec4d T G 6: 123,270,529 probably null Het
Disp2 T C 2: 118,786,921 L132P probably damaging Het
Dync2h1 T C 9: 7,165,677 K528R probably benign Het
Fbxw26 A G 9: 109,717,965 I464T possibly damaging Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gabbr2 A G 4: 46,804,069 V262A probably damaging Het
Galnt17 T A 5: 131,081,596 M302L probably benign Het
Gm5096 C T 18: 87,757,217 A288V probably damaging Het
Gpn3 T C 5: 122,382,112 I243T probably benign Het
Gpr160 T C 3: 30,895,992 V71A possibly damaging Het
Gramd1b G T 9: 40,333,650 A154D probably damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
H60b C A 10: 22,287,144 T206N probably benign Het
Hydin A T 8: 110,593,802 I4493F probably benign Het
Il19 C T 1: 130,939,115 E43K possibly damaging Het
Ints2 A G 11: 86,225,058 Y782H probably damaging Het
Jph1 C A 1: 17,097,586 D7Y probably damaging Het
Lipo2 T C 19: 33,749,452 I62V probably damaging Het
Map7 G A 10: 20,276,280 probably null Het
Matk T G 10: 81,259,588 W81G probably damaging Het
Matn4 T C 2: 164,400,815 Y121C probably damaging Het
Mical2 G A 7: 112,324,086 probably null Het
Miga2 T G 2: 30,381,662 Y399D probably damaging Het
Mocos A T 18: 24,666,615 E302V probably benign Het
Mrpl11 C T 19: 4,964,715 A172V probably damaging Het
Mrpl48 A C 7: 100,559,794 Y108D probably damaging Het
Mtr A G 13: 12,190,392 S1061P probably benign Het
Myh11 T A 16: 14,208,291 K1309* probably null Het
Myom2 G A 8: 15,104,173 V704I possibly damaging Het
Nars2 A G 7: 97,057,521 H413R probably benign Het
Nckap1 A G 2: 80,525,602 L619P probably damaging Het
Notch1 T C 2: 26,472,805 N983S probably damaging Het
Nup210 A G 6: 91,025,355 V717A probably benign Het
P4ha3 G T 7: 100,317,085 G479V probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Phf11a A G 14: 59,287,579 S59P probably damaging Het
Phyhip G A 14: 70,463,358 S95N probably benign Het
Ppat A G 5: 76,918,146 V375A probably benign Het
Prkdc A G 16: 15,790,592 E3086G probably damaging Het
Psg22 A G 7: 18,719,674 E98G probably damaging Het
Rabgap1 A T 2: 37,563,598 K1013* probably null Het
Retreg3 C T 11: 101,119,700 G27D probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sema6a A T 18: 47,298,302 probably null Het
Sept10 T C 10: 59,170,848 E349G probably damaging Het
Serpina1c A G 12: 103,897,170 V257A probably damaging Het
Sgpp2 T A 1: 78,390,482 M84K probably damaging Het
Skint11 A G 4: 114,244,710 S116G possibly damaging Het
Slc2a5 G A 4: 150,143,100 V459I probably benign Het
Smarca2 T G 19: 26,771,004 Y126* probably null Het
Stab2 T G 10: 86,923,003 N1024H possibly damaging Het
Svep1 A C 4: 58,128,869 F609L probably benign Het
Tbc1d2 G A 4: 46,614,068 T671I probably damaging Het
Thoc5 T C 11: 4,905,697 I82T probably damaging Het
Tmem173 A T 18: 35,736,102 I178N probably damaging Het
Tmem213 G T 6: 38,115,582 C83F probably damaging Het
Topaz1 G A 9: 122,750,505 D827N possibly damaging Het
Trappc10 C A 10: 78,214,812 G265V possibly damaging Het
Ttn A G 2: 76,709,464 S26066P probably damaging Het
Zfp292 G T 4: 34,809,442 Q1201K probably benign Het
Zfp354a T A 11: 51,060,988 probably null Het
Zfp418 T C 7: 7,182,097 V353A possibly damaging Het
Zfp444 G A 7: 6,189,949 probably benign Het
Zfp503 C A 14: 21,985,710 Q379H probably damaging Het
Zfp804a A G 2: 82,258,118 K764E probably damaging Het
Other mutations in Ccdc129
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ccdc129 APN 6 55968037 missense possibly damaging 0.90
IGL01317:Ccdc129 APN 6 55967805 missense possibly damaging 0.77
IGL01390:Ccdc129 APN 6 55897998 missense probably benign 0.41
IGL01696:Ccdc129 APN 6 55897695 missense probably benign 0.40
IGL01941:Ccdc129 APN 6 55968045 missense probably benign
IGL01967:Ccdc129 APN 6 55897911 missense probably damaging 0.99
IGL02071:Ccdc129 APN 6 55967725 nonsense probably null
IGL02232:Ccdc129 APN 6 55967937 missense unknown
IGL02268:Ccdc129 APN 6 55884688 splice site probably benign
IGL02440:Ccdc129 APN 6 55884728 missense possibly damaging 0.95
IGL02614:Ccdc129 APN 6 55968277 missense probably damaging 0.99
IGL02626:Ccdc129 APN 6 55968646 missense probably benign 0.03
IGL02674:Ccdc129 APN 6 55897928 missense probably benign 0.04
IGL02836:Ccdc129 APN 6 55898090 missense probably damaging 1.00
IGL02884:Ccdc129 APN 6 55874354 splice site probably null
IGL02889:Ccdc129 APN 6 55901458 missense possibly damaging 0.46
IGL03103:Ccdc129 APN 6 55968159 missense possibly damaging 0.59
IGL03117:Ccdc129 APN 6 55898129 missense probably benign 0.25
IGL03343:Ccdc129 APN 6 55968584 missense probably damaging 1.00
R0054:Ccdc129 UTSW 6 55872472 utr 5 prime probably benign
R0200:Ccdc129 UTSW 6 55897956 missense probably benign 0.10
R0245:Ccdc129 UTSW 6 55898007 missense probably damaging 1.00
R0320:Ccdc129 UTSW 6 55976447 missense probably damaging 1.00
R0326:Ccdc129 UTSW 6 55898243 missense possibly damaging 0.61
R0357:Ccdc129 UTSW 6 55968034 missense probably benign 0.13
R1109:Ccdc129 UTSW 6 55968260 missense probably damaging 1.00
R1118:Ccdc129 UTSW 6 55889170 missense probably damaging 1.00
R1119:Ccdc129 UTSW 6 55889170 missense probably damaging 1.00
R1462:Ccdc129 UTSW 6 55975664 missense probably damaging 1.00
R1462:Ccdc129 UTSW 6 55975664 missense probably damaging 1.00
R1588:Ccdc129 UTSW 6 55978503 missense possibly damaging 0.72
R1678:Ccdc129 UTSW 6 55968514 missense probably benign 0.35
R1680:Ccdc129 UTSW 6 55968766 missense probably damaging 1.00
R1728:Ccdc129 UTSW 6 55968541 missense probably benign 0.01
R1729:Ccdc129 UTSW 6 55968541 missense probably benign 0.01
R1737:Ccdc129 UTSW 6 55968304 missense probably damaging 1.00
R1771:Ccdc129 UTSW 6 55898147 missense probably benign 0.40
R1784:Ccdc129 UTSW 6 55968541 missense probably benign 0.01
R1936:Ccdc129 UTSW 6 55897681 missense probably damaging 1.00
R1995:Ccdc129 UTSW 6 55968709 missense probably benign 0.03
R2037:Ccdc129 UTSW 6 55897875 missense probably benign 0.00
R2137:Ccdc129 UTSW 6 55889189 missense probably damaging 1.00
R2190:Ccdc129 UTSW 6 55897700 missense possibly damaging 0.87
R2191:Ccdc129 UTSW 6 55967719 missense probably benign 0.06
R2234:Ccdc129 UTSW 6 55897812 missense possibly damaging 0.67
R2235:Ccdc129 UTSW 6 55897812 missense possibly damaging 0.67
R3793:Ccdc129 UTSW 6 55975603 missense possibly damaging 0.80
R3923:Ccdc129 UTSW 6 55968060 missense probably benign 0.19
R3959:Ccdc129 UTSW 6 55897740 missense probably benign
R4332:Ccdc129 UTSW 6 55968235 missense possibly damaging 0.95
R4485:Ccdc129 UTSW 6 55887066 missense probably benign 0.00
R4688:Ccdc129 UTSW 6 55967147 splice site probably null
R4916:Ccdc129 UTSW 6 55978190 missense possibly damaging 0.77
R5201:Ccdc129 UTSW 6 55968006 missense probably benign 0.03
R5383:Ccdc129 UTSW 6 55978290 missense probably benign 0.38
R5450:Ccdc129 UTSW 6 55968811 critical splice donor site probably null
R5542:Ccdc129 UTSW 6 55978395 missense probably damaging 0.99
R5819:Ccdc129 UTSW 6 55897891 missense probably benign 0.18
R5935:Ccdc129 UTSW 6 55897769 nonsense probably null
R6034:Ccdc129 UTSW 6 55967681 missense possibly damaging 0.94
R6034:Ccdc129 UTSW 6 55967681 missense possibly damaging 0.94
R6246:Ccdc129 UTSW 6 55967672 missense probably damaging 1.00
R6463:Ccdc129 UTSW 6 55968678 missense probably benign 0.17
R6490:Ccdc129 UTSW 6 55976420 missense probably damaging 1.00
R6948:Ccdc129 UTSW 6 55978485 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTGGAGAGGCTGATTATGGAAAAC -3'
(R):5'- TGCAGCAATCCTCAAGTACTC -3'

Sequencing Primer
(F):5'- TTATGGAAAACAGGAGGTTGTGCC -3'
(R):5'- TTAATATGAAAACCCATACTTCTCCC -3'
Posted On2018-02-27