Incidental Mutation 'R6209:Map7'
ID503343
Institutional Source Beutler Lab
Gene Symbol Map7
Ensembl Gene ENSMUSG00000019996
Gene Namemicrotubule-associated protein 7
SynonymsE-MAP-115, mste, ste, Mtap7, mshi
MMRRC Submission 044343-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R6209 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location20148471-20281590 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 20276280 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020173] [ENSMUST00000116259]
Predicted Effect probably null
Transcript: ENSMUST00000020173
SMART Domains Protein: ENSMUSP00000020173
Gene: ENSMUSG00000019996

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
low complexity region 55 85 N/A INTRINSIC
coiled coil region 89 152 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 379 392 N/A INTRINSIC
Pfam:MAP7 447 616 1.1e-59 PFAM
internal_repeat_1 623 658 5.23e-6 PROSPERO
internal_repeat_1 699 736 5.23e-6 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000116259
SMART Domains Protein: ENSMUSP00000111963
Gene: ENSMUSG00000019996

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
low complexity region 55 85 N/A INTRINSIC
coiled coil region 89 152 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 379 392 N/A INTRINSIC
Pfam:MAP7 453 611 4.7e-46 PFAM
internal_repeat_1 623 656 2.41e-5 PROSPERO
internal_repeat_1 699 734 2.41e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217535
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a microtubule-associated protein that is predominantly expressed in cells of epithelial origin. Microtubule-associated proteins are thought to be involved in microtubule dynamics, which is essential for cell polarization and differentiation. This protein has been shown to be able to stabilize microtubules, and may serve to modulate microtubule functions. Studies of the related mouse protein also suggested an essential role in microtubule function required for spermatogenesis. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]
PHENOTYPE: Males homozygous for mutations in this marker are sterile with small, disorganized testes, small epidiymis and seminiferous tubules. They have deformed spermatid nuclei and a block in spermatogenesis. Aberrant microtubules are seen in elongating spermatids and sertoli cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 T A 1: 38,193,589 M990L probably benign Het
Agl A T 3: 116,785,196 Y429* probably null Het
Ahnak A T 19: 9,012,566 K3738M probably damaging Het
AI481877 A G 4: 59,043,869 *1482R probably null Het
Amn G T 12: 111,275,411 V304L probably damaging Het
Ap3s1 G A 18: 46,779,251 V113I probably benign Het
Arhgef28 A T 13: 97,929,409 probably null Het
Atad2 A G 15: 58,118,415 S18P probably damaging Het
C4b T A 17: 34,741,087 E305V possibly damaging Het
Caskin1 T C 17: 24,507,121 S1401P possibly damaging Het
Cblc A T 7: 19,785,305 V366D possibly damaging Het
Ccdc129 T A 6: 55,874,321 I62N probably damaging Het
Cdk17 A T 10: 93,208,231 T11S probably benign Het
Cenpc1 A G 5: 86,033,650 S619P probably benign Het
Clec4d T G 6: 123,270,529 probably null Het
Disp2 T C 2: 118,786,921 L132P probably damaging Het
Dync2h1 T C 9: 7,165,677 K528R probably benign Het
Fbxw26 A G 9: 109,717,965 I464T possibly damaging Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gabbr2 A G 4: 46,804,069 V262A probably damaging Het
Galnt17 T A 5: 131,081,596 M302L probably benign Het
Gm5096 C T 18: 87,757,217 A288V probably damaging Het
Gpn3 T C 5: 122,382,112 I243T probably benign Het
Gpr160 T C 3: 30,895,992 V71A possibly damaging Het
Gramd1b G T 9: 40,333,650 A154D probably damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
H60b C A 10: 22,287,144 T206N probably benign Het
Hydin A T 8: 110,593,802 I4493F probably benign Het
Il19 C T 1: 130,939,115 E43K possibly damaging Het
Ints2 A G 11: 86,225,058 Y782H probably damaging Het
Jph1 C A 1: 17,097,586 D7Y probably damaging Het
Lipo2 T C 19: 33,749,452 I62V probably damaging Het
Matk T G 10: 81,259,588 W81G probably damaging Het
Matn4 T C 2: 164,400,815 Y121C probably damaging Het
Mical2 G A 7: 112,324,086 probably null Het
Miga2 T G 2: 30,381,662 Y399D probably damaging Het
Mocos A T 18: 24,666,615 E302V probably benign Het
Mrpl11 C T 19: 4,964,715 A172V probably damaging Het
Mrpl48 A C 7: 100,559,794 Y108D probably damaging Het
Mtr A G 13: 12,190,392 S1061P probably benign Het
Myh11 T A 16: 14,208,291 K1309* probably null Het
Myom2 G A 8: 15,104,173 V704I possibly damaging Het
Nars2 A G 7: 97,057,521 H413R probably benign Het
Nckap1 A G 2: 80,525,602 L619P probably damaging Het
Notch1 T C 2: 26,472,805 N983S probably damaging Het
Nup210 A G 6: 91,025,355 V717A probably benign Het
P4ha3 G T 7: 100,317,085 G479V probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Phf11a A G 14: 59,287,579 S59P probably damaging Het
Phyhip G A 14: 70,463,358 S95N probably benign Het
Ppat A G 5: 76,918,146 V375A probably benign Het
Prkdc A G 16: 15,790,592 E3086G probably damaging Het
Psg22 A G 7: 18,719,674 E98G probably damaging Het
Rabgap1 A T 2: 37,563,598 K1013* probably null Het
Retreg3 C T 11: 101,119,700 G27D probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sema6a A T 18: 47,298,302 probably null Het
Sept10 T C 10: 59,170,848 E349G probably damaging Het
Serpina1c A G 12: 103,897,170 V257A probably damaging Het
Sgpp2 T A 1: 78,390,482 M84K probably damaging Het
Skint11 A G 4: 114,244,710 S116G possibly damaging Het
Slc2a5 G A 4: 150,143,100 V459I probably benign Het
Smarca2 T G 19: 26,771,004 Y126* probably null Het
Stab2 T G 10: 86,923,003 N1024H possibly damaging Het
Svep1 A C 4: 58,128,869 F609L probably benign Het
Tbc1d2 G A 4: 46,614,068 T671I probably damaging Het
Thoc5 T C 11: 4,905,697 I82T probably damaging Het
Tmem173 A T 18: 35,736,102 I178N probably damaging Het
Tmem213 G T 6: 38,115,582 C83F probably damaging Het
Topaz1 G A 9: 122,750,505 D827N possibly damaging Het
Trappc10 C A 10: 78,214,812 G265V possibly damaging Het
Ttn A G 2: 76,709,464 S26066P probably damaging Het
Zfp292 G T 4: 34,809,442 Q1201K probably benign Het
Zfp354a T A 11: 51,060,988 probably null Het
Zfp418 T C 7: 7,182,097 V353A possibly damaging Het
Zfp444 G A 7: 6,189,949 probably benign Het
Zfp503 C A 14: 21,985,710 Q379H probably damaging Het
Zfp804a A G 2: 82,258,118 K764E probably damaging Het
Other mutations in Map7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Map7 APN 10 20273804 missense unknown
IGL03019:Map7 APN 10 20267355 missense unknown
IGL03263:Map7 APN 10 20245322 nonsense probably null
R0893:Map7 UTSW 10 20273883 splice site probably null
R1172:Map7 UTSW 10 20245299 missense probably damaging 1.00
R2097:Map7 UTSW 10 20246616 missense probably damaging 1.00
R2239:Map7 UTSW 10 20278282 missense unknown
R3760:Map7 UTSW 10 20276281 splice site probably benign
R3980:Map7 UTSW 10 20267353 missense unknown
R5009:Map7 UTSW 10 20261918 nonsense probably null
R5397:Map7 UTSW 10 20273321 missense unknown
R5422:Map7 UTSW 10 20266766 missense probably damaging 0.99
R5501:Map7 UTSW 10 20276202 missense unknown
R5664:Map7 UTSW 10 20267359 missense unknown
R5773:Map7 UTSW 10 20246644 missense probably benign 0.22
R6438:Map7 UTSW 10 20267257 missense unknown
R6446:Map7 UTSW 10 20278233 missense unknown
R6919:Map7 UTSW 10 20171082 start gained probably benign
X0022:Map7 UTSW 10 20269582 missense unknown
Predicted Primers PCR Primer
(F):5'- GGCAGTGAGTTGTACAGTCAGG -3'
(R):5'- ATGAAGCTGGCTGTAATTTTCC -3'

Sequencing Primer
(F):5'- CAGTCAGGTCAGATATCCAGGTTC -3'
(R):5'- GGCTGTAATTTTCCTTAATACGCAC -3'
Posted On2018-02-27