Incidental Mutation 'R6209:Arhgef28'
ID503359
Institutional Source Beutler Lab
Gene Symbol Arhgef28
Ensembl Gene ENSMUSG00000021662
Gene NameRho guanine nucleotide exchange factor (GEF) 28
SynonymsRhoGEF, Rgnef, Rho specific exchange factor, p190RhoGEF, 9230110L08Rik, D13Bwg1089e, RIP2
MMRRC Submission 044343-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.739) question?
Stock #R6209 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location97899469-98206439 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 97929409 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109426] [ENSMUST00000225884]
Predicted Effect probably null
Transcript: ENSMUST00000109426
SMART Domains Protein: ENSMUSP00000105053
Gene: ENSMUSG00000021662

DomainStartEndE-ValueType
low complexity region 530 568 N/A INTRINSIC
low complexity region 634 650 N/A INTRINSIC
C1 652 698 1.65e-11 SMART
RhoGEF 850 1040 1.11e-65 SMART
PH 1084 1187 1.08e-9 SMART
low complexity region 1267 1281 N/A INTRINSIC
coiled coil region 1469 1522 N/A INTRINSIC
low complexity region 1647 1663 N/A INTRINSIC
low complexity region 1682 1693 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225663
Predicted Effect probably benign
Transcript: ENSMUST00000225884
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho guanine nucleotide exchange factor family. The encoded protein interacts with low molecular weight neurofilament mRNA and may be involved in the formation of amyotrophic lateral sclerosis neurofilament aggregates. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are born at lower than expected Mendelian ratios and exhibit a reduction in overall size that becomes negligible by 8 weeks of age. Mouse embryonic fibroblasts display defects in cell migration and focal adhesion formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 T A 1: 38,193,589 M990L probably benign Het
Agl A T 3: 116,785,196 Y429* probably null Het
Ahnak A T 19: 9,012,566 K3738M probably damaging Het
AI481877 A G 4: 59,043,869 *1482R probably null Het
Amn G T 12: 111,275,411 V304L probably damaging Het
Ap3s1 G A 18: 46,779,251 V113I probably benign Het
Atad2 A G 15: 58,118,415 S18P probably damaging Het
C4b T A 17: 34,741,087 E305V possibly damaging Het
Caskin1 T C 17: 24,507,121 S1401P possibly damaging Het
Cblc A T 7: 19,785,305 V366D possibly damaging Het
Ccdc129 T A 6: 55,874,321 I62N probably damaging Het
Cdk17 A T 10: 93,208,231 T11S probably benign Het
Cenpc1 A G 5: 86,033,650 S619P probably benign Het
Clec4d T G 6: 123,270,529 probably null Het
Disp2 T C 2: 118,786,921 L132P probably damaging Het
Dync2h1 T C 9: 7,165,677 K528R probably benign Het
Fbxw26 A G 9: 109,717,965 I464T possibly damaging Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gabbr2 A G 4: 46,804,069 V262A probably damaging Het
Galnt17 T A 5: 131,081,596 M302L probably benign Het
Gm5096 C T 18: 87,757,217 A288V probably damaging Het
Gpn3 T C 5: 122,382,112 I243T probably benign Het
Gpr160 T C 3: 30,895,992 V71A possibly damaging Het
Gramd1b G T 9: 40,333,650 A154D probably damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
H60b C A 10: 22,287,144 T206N probably benign Het
Hydin A T 8: 110,593,802 I4493F probably benign Het
Il19 C T 1: 130,939,115 E43K possibly damaging Het
Ints2 A G 11: 86,225,058 Y782H probably damaging Het
Jph1 C A 1: 17,097,586 D7Y probably damaging Het
Lipo2 T C 19: 33,749,452 I62V probably damaging Het
Map7 G A 10: 20,276,280 probably null Het
Matk T G 10: 81,259,588 W81G probably damaging Het
Matn4 T C 2: 164,400,815 Y121C probably damaging Het
Mical2 G A 7: 112,324,086 probably null Het
Miga2 T G 2: 30,381,662 Y399D probably damaging Het
Mocos A T 18: 24,666,615 E302V probably benign Het
Mrpl11 C T 19: 4,964,715 A172V probably damaging Het
Mrpl48 A C 7: 100,559,794 Y108D probably damaging Het
Mtr A G 13: 12,190,392 S1061P probably benign Het
Myh11 T A 16: 14,208,291 K1309* probably null Het
Myom2 G A 8: 15,104,173 V704I possibly damaging Het
Nars2 A G 7: 97,057,521 H413R probably benign Het
Nckap1 A G 2: 80,525,602 L619P probably damaging Het
Notch1 T C 2: 26,472,805 N983S probably damaging Het
Nup210 A G 6: 91,025,355 V717A probably benign Het
P4ha3 G T 7: 100,317,085 G479V probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Phf11a A G 14: 59,287,579 S59P probably damaging Het
Phyhip G A 14: 70,463,358 S95N probably benign Het
Ppat A G 5: 76,918,146 V375A probably benign Het
Prkdc A G 16: 15,790,592 E3086G probably damaging Het
Psg22 A G 7: 18,719,674 E98G probably damaging Het
Rabgap1 A T 2: 37,563,598 K1013* probably null Het
Retreg3 C T 11: 101,119,700 G27D probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sema6a A T 18: 47,298,302 probably null Het
Sept10 T C 10: 59,170,848 E349G probably damaging Het
Serpina1c A G 12: 103,897,170 V257A probably damaging Het
Sgpp2 T A 1: 78,390,482 M84K probably damaging Het
Skint11 A G 4: 114,244,710 S116G possibly damaging Het
Slc2a5 G A 4: 150,143,100 V459I probably benign Het
Smarca2 T G 19: 26,771,004 Y126* probably null Het
Stab2 T G 10: 86,923,003 N1024H possibly damaging Het
Svep1 A C 4: 58,128,869 F609L probably benign Het
Tbc1d2 G A 4: 46,614,068 T671I probably damaging Het
Thoc5 T C 11: 4,905,697 I82T probably damaging Het
Tmem173 A T 18: 35,736,102 I178N probably damaging Het
Tmem213 G T 6: 38,115,582 C83F probably damaging Het
Topaz1 G A 9: 122,750,505 D827N possibly damaging Het
Trappc10 C A 10: 78,214,812 G265V possibly damaging Het
Ttn A G 2: 76,709,464 S26066P probably damaging Het
Zfp292 G T 4: 34,809,442 Q1201K probably benign Het
Zfp354a T A 11: 51,060,988 probably null Het
Zfp418 T C 7: 7,182,097 V353A possibly damaging Het
Zfp444 G A 7: 6,189,949 probably benign Het
Zfp503 C A 14: 21,985,710 Q379H probably damaging Het
Zfp804a A G 2: 82,258,118 K764E probably damaging Het
Other mutations in Arhgef28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Arhgef28 APN 13 97988277 missense probably benign 0.15
IGL00945:Arhgef28 APN 13 97967399 missense possibly damaging 0.88
IGL01099:Arhgef28 APN 13 97953972 splice site probably benign
IGL01328:Arhgef28 APN 13 97970323 missense probably damaging 1.00
IGL01396:Arhgef28 APN 13 97953893 missense probably damaging 0.99
IGL02067:Arhgef28 APN 13 98077317 missense probably damaging 1.00
IGL02147:Arhgef28 APN 13 97961314 missense probably damaging 1.00
IGL02285:Arhgef28 APN 13 98051028 missense possibly damaging 0.85
IGL02439:Arhgef28 APN 13 97931139 missense possibly damaging 0.75
IGL02499:Arhgef28 APN 13 97953783 missense possibly damaging 0.87
IGL02532:Arhgef28 APN 13 98029883 missense probably damaging 0.99
IGL02634:Arhgef28 APN 13 98051058 missense probably benign 0.00
IGL02902:Arhgef28 APN 13 97946875 missense probably damaging 1.00
IGL03067:Arhgef28 APN 13 97988286 missense probably benign 0.00
IGL03081:Arhgef28 APN 13 98029373 splice site probably benign
IGL03106:Arhgef28 APN 13 97957793 missense probably damaging 1.00
IGL03195:Arhgef28 APN 13 97951563 splice site probably null
IGL03325:Arhgef28 APN 13 97899816 missense probably benign 0.03
H8786:Arhgef28 UTSW 13 97946953 missense probably damaging 1.00
R0027:Arhgef28 UTSW 13 97945696 missense possibly damaging 0.94
R0027:Arhgef28 UTSW 13 97945696 missense possibly damaging 0.94
R0062:Arhgef28 UTSW 13 97956642 missense possibly damaging 0.56
R0062:Arhgef28 UTSW 13 97956642 missense possibly damaging 0.56
R0090:Arhgef28 UTSW 13 98075110 missense probably damaging 0.99
R0096:Arhgef28 UTSW 13 97931254 missense probably damaging 1.00
R0096:Arhgef28 UTSW 13 97931254 missense probably damaging 1.00
R0537:Arhgef28 UTSW 13 97957716 missense probably damaging 1.00
R0617:Arhgef28 UTSW 13 97970355 missense probably benign 0.21
R0711:Arhgef28 UTSW 13 97931254 missense probably damaging 1.00
R0723:Arhgef28 UTSW 13 97939479 missense probably benign 0.16
R0790:Arhgef28 UTSW 13 97981406 missense possibly damaging 0.51
R1240:Arhgef28 UTSW 13 97929492 missense probably benign 0.00
R1365:Arhgef28 UTSW 13 98075124 missense probably damaging 1.00
R1456:Arhgef28 UTSW 13 98075002 missense probably benign 0.01
R1490:Arhgef28 UTSW 13 97978444 missense probably damaging 1.00
R1496:Arhgef28 UTSW 13 97965546 missense possibly damaging 0.93
R1660:Arhgef28 UTSW 13 97981376 missense probably benign 0.05
R1671:Arhgef28 UTSW 13 97931034 missense possibly damaging 0.95
R1747:Arhgef28 UTSW 13 97936824 missense probably damaging 1.00
R1792:Arhgef28 UTSW 13 97931186 missense probably benign 0.03
R1864:Arhgef28 UTSW 13 97994132 missense probably benign 0.00
R1887:Arhgef28 UTSW 13 98145573 missense probably damaging 0.97
R1924:Arhgef28 UTSW 13 97936816 splice site probably benign
R1987:Arhgef28 UTSW 13 97967096 missense probably benign
R2215:Arhgef28 UTSW 13 98051021 missense possibly damaging 0.78
R2342:Arhgef28 UTSW 13 97994029 missense probably benign 0.00
R2495:Arhgef28 UTSW 13 98029373 splice site probably benign
R3897:Arhgef28 UTSW 13 97956576 missense probably damaging 1.00
R3922:Arhgef28 UTSW 13 97993944 missense possibly damaging 0.92
R4063:Arhgef28 UTSW 13 97994067 missense probably benign 0.16
R4086:Arhgef28 UTSW 13 97967204 missense probably damaging 0.98
R4543:Arhgef28 UTSW 13 98075000 missense probably benign 0.00
R4730:Arhgef28 UTSW 13 97978142 missense probably benign 0.00
R4735:Arhgef28 UTSW 13 97899729 missense probably damaging 1.00
R4953:Arhgef28 UTSW 13 97929554 missense possibly damaging 0.51
R5069:Arhgef28 UTSW 13 98075206 missense probably damaging 0.96
R5558:Arhgef28 UTSW 13 97961460 missense probably damaging 1.00
R5573:Arhgef28 UTSW 13 97929491 missense probably benign 0.01
R5594:Arhgef28 UTSW 13 97939492 missense probably benign 0.00
R5937:Arhgef28 UTSW 13 97939543 missense probably benign 0.00
R5987:Arhgef28 UTSW 13 97936860 nonsense probably null
R6015:Arhgef28 UTSW 13 98075022 missense possibly damaging 0.73
R6193:Arhgef28 UTSW 13 97985380 missense probably damaging 1.00
R6306:Arhgef28 UTSW 13 97985388 missense probably damaging 1.00
R6393:Arhgef28 UTSW 13 97994019 missense possibly damaging 0.64
R6562:Arhgef28 UTSW 13 97988139 critical splice donor site probably null
R6646:Arhgef28 UTSW 13 97939494 missense probably benign 0.09
R6655:Arhgef28 UTSW 13 97899655 missense probably damaging 1.00
R6707:Arhgef28 UTSW 13 97936716 missense probably damaging 0.96
R6707:Arhgef28 UTSW 13 98075116 missense possibly damaging 0.80
R6751:Arhgef28 UTSW 13 98075247 missense probably damaging 0.97
R6940:Arhgef28 UTSW 13 97965530 missense possibly damaging 0.58
R7018:Arhgef28 UTSW 13 97965435 missense probably damaging 1.00
R7030:Arhgef28 UTSW 13 97988261 missense possibly damaging 0.88
R7120:Arhgef28 UTSW 13 97944539 missense probably damaging 1.00
R7266:Arhgef28 UTSW 13 97965452 missense probably benign
Z1088:Arhgef28 UTSW 13 97945691 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCACAAGGCCTCGTTTATTTAG -3'
(R):5'- GACACATGTCACTTAACACGTC -3'

Sequencing Primer
(F):5'- TAGATATTTAGGAGTACAGGGGACTC -3'
(R):5'- TCCCCTGGGATGCTCAC -3'
Posted On2018-02-27