Incidental Mutation 'R6210:Olfr330'
ID503416
Institutional Source Beutler Lab
Gene Symbol Olfr330
Ensembl Gene ENSMUSG00000050818
Gene Nameolfactory receptor 330
SynonymsMOR275-1, GA_x6K02T2NKPP-895420-896349
MMRRC Submission 044344-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6210 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location58527186-58534836 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58529264 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 241 (A241T)
Ref Sequence ENSEMBL: ENSMUSP00000149073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134055] [ENSMUST00000213188]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117184
Predicted Effect probably damaging
Transcript: ENSMUST00000134055
AA Change: A241T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000145126
Gene: ENSMUSG00000050818
AA Change: A241T

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 1.6e-46 PFAM
Pfam:7TM_GPCR_Srsx 39 309 4.4e-6 PFAM
Pfam:7tm_1 45 294 2.3e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213188
AA Change: A241T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.182 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 T A 18: 10,706,032 I94F probably damaging Het
Bbox1 A T 2: 110,270,077 D258E probably benign Het
Catsperb A G 12: 101,412,568 probably null Het
Ccdc127 T C 13: 74,356,921 V196A probably benign Het
Cd101 A T 3: 101,018,643 D253E probably damaging Het
Ceacam15 T C 7: 16,673,289 Y101C probably damaging Het
Cep135 C T 5: 76,624,723 L652F probably benign Het
Col5a1 G T 2: 28,032,621 V234L probably benign Het
Cxcr6 T C 9: 123,810,008 S25P possibly damaging Het
D17Wsu92e A T 17: 27,767,986 D255E probably benign Het
Dctn4 C T 18: 60,546,793 Q258* probably null Het
Fmnl2 A T 2: 53,130,445 N1067I possibly damaging Het
Frrs1 A T 3: 116,878,431 K59N probably benign Het
Gpr157 T C 4: 150,101,598 Y206H probably damaging Het
Hephl1 A G 9: 15,090,564 Y161H possibly damaging Het
Hinfp C T 9: 44,298,872 probably null Het
Igf2r A T 17: 12,714,951 N805K probably damaging Het
Itga3 T C 11: 95,068,891 probably benign Het
Itga6 A G 2: 71,834,007 probably null Het
Kcnip1 G A 11: 33,645,600 T30I possibly damaging Het
Lig4 T C 8: 9,971,585 T732A probably benign Het
Lmod3 T A 6: 97,247,301 T520S probably damaging Het
Megf8 G A 7: 25,343,720 V1356I possibly damaging Het
Mical3 C T 6: 121,040,517 probably null Het
Msi1 T C 5: 115,435,476 I8T probably damaging Het
Mug4-ps A T 6: 121,950,317 noncoding transcript Het
Myo1f T A 17: 33,601,070 I783N probably damaging Het
Nr6a1 A C 2: 38,729,497 I462S probably damaging Het
Olfr1056 A G 2: 86,356,358 V8A probably benign Het
Pah C A 10: 87,583,561 Q449K probably benign Het
Pced1a A G 2: 130,421,919 V271A probably damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Psg21 A G 7: 18,652,345 Y239H probably damaging Het
Ptprt T C 2: 162,268,029 Y180C probably damaging Het
Raet1d T A 10: 22,370,950 I59N probably damaging Het
Rfx1 T C 8: 84,093,018 L653P probably damaging Het
Rnase2a A G 14: 51,255,674 V78A possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Serbp1 T C 6: 67,272,867 probably benign Het
Tlr1 A T 5: 64,925,286 H649Q probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpc6 T A 9: 8,656,730 D719E probably benign Het
Ttc21b A T 2: 66,236,354 S318R probably benign Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Uhmk1 T C 1: 170,212,237 Q187R probably damaging Het
Ung C T 5: 114,131,377 A50V probably benign Het
Upk3bl C T 5: 136,059,820 Q103* probably null Het
Usp17le C A 7: 104,769,143 C264F probably damaging Het
Vmn2r105 T A 17: 20,228,496 N140Y probably damaging Het
Vmn2r84 C T 10: 130,386,245 C702Y probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp748 G A 13: 67,540,804 P779L possibly damaging Het
Other mutations in Olfr330
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Olfr330 APN 11 58529396 missense probably benign 0.17
IGL01672:Olfr330 APN 11 58529122 missense probably benign 0.43
IGL01782:Olfr330 APN 11 58529159 missense probably benign 0.03
IGL01998:Olfr330 APN 11 58529577 nonsense probably null
IGL02538:Olfr330 APN 11 58529990 utr 5 prime probably benign
R1670:Olfr330 UTSW 11 58529411 missense probably damaging 1.00
R1727:Olfr330 UTSW 11 58529516 missense possibly damaging 0.51
R1768:Olfr330 UTSW 11 58529776 missense probably damaging 1.00
R1839:Olfr330 UTSW 11 58529373 nonsense probably null
R2129:Olfr330 UTSW 11 58529611 missense probably damaging 1.00
R2135:Olfr330 UTSW 11 58529785 missense probably damaging 1.00
R2425:Olfr330 UTSW 11 58529311 missense probably damaging 1.00
R3753:Olfr330 UTSW 11 58529690 missense probably benign 0.00
R4480:Olfr330 UTSW 11 58529801 missense probably damaging 0.99
R4827:Olfr330 UTSW 11 58529596 missense probably damaging 0.99
R4836:Olfr330 UTSW 11 58529482 missense probably damaging 0.99
R4973:Olfr330 UTSW 11 58529077 missense probably benign
R5128:Olfr330 UTSW 11 58529422 missense probably damaging 0.98
R5288:Olfr330 UTSW 11 58529482 missense probably damaging 0.99
R5326:Olfr330 UTSW 11 58529884 missense probably benign 0.02
R5542:Olfr330 UTSW 11 58529884 missense probably benign 0.02
R5620:Olfr330 UTSW 11 58529731 missense probably damaging 0.99
R7163:Olfr330 UTSW 11 58529168 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTTCTCAGAAGAGGGTGCTC -3'
(R):5'- TTCCTGCTGTGACAAAGCTC -3'

Sequencing Primer
(F):5'- GAGGGTGCTCACAACTAACAGTTTC -3'
(R):5'- GTGACAAAGCTCTCCTGCTCAG -3'
Posted On2018-02-27