Incidental Mutation 'R6212:Oaz3'
ID503487
Institutional Source Beutler Lab
Gene Symbol Oaz3
Ensembl Gene ENSMUSG00000028141
Gene Nameornithine decarboxylase antizyme 3
SynonymsAZ-3, Oaz-t, antizyme 3, AZ3, ornithine decarboxylase antizyme in testis
MMRRC Submission 044345-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R6212 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location94432414-94443915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94435068 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 139 (T139S)
Ref Sequence ENSEMBL: ENSMUSP00000143080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045245] [ENSMUST00000166032] [ENSMUST00000191506] [ENSMUST00000196606] [ENSMUST00000197495] [ENSMUST00000197901] [ENSMUST00000199678] [ENSMUST00000203883] [ENSMUST00000204548] [ENSMUST00000204913]
Predicted Effect probably benign
Transcript: ENSMUST00000045245
SMART Domains Protein: ENSMUSP00000041002
Gene: ENSMUSG00000041912

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 120 9.32e-17 SMART
KH 123 195 3.93e-15 SMART
TUDOR 352 410 2.79e-6 SMART
low complexity region 429 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166032
SMART Domains Protein: ENSMUSP00000129635
Gene: ENSMUSG00000041912

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 120 9.32e-17 SMART
KH 123 195 3.93e-15 SMART
TUDOR 352 410 2.79e-6 SMART
low complexity region 429 434 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000191506
AA Change: T139S
SMART Domains Protein: ENSMUSP00000139408
Gene: ENSMUSG00000028141
AA Change: T139S

DomainStartEndE-ValueType
low complexity region 67 88 N/A INTRINSIC
Pfam:ODC_AZ 137 233 1.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196606
SMART Domains Protein: ENSMUSP00000143102
Gene: ENSMUSG00000041912

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 116 1.5e-11 SMART
KH 119 191 2.4e-17 SMART
TUDOR 348 406 1.7e-8 SMART
low complexity region 425 430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196799
Predicted Effect probably benign
Transcript: ENSMUST00000197495
SMART Domains Protein: ENSMUSP00000143135
Gene: ENSMUSG00000041912

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 150 3e-18 SMART
TUDOR 307 365 1.7e-8 SMART
low complexity region 384 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197901
SMART Domains Protein: ENSMUSP00000142561
Gene: ENSMUSG00000041912

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 120 9.32e-17 SMART
KH 123 195 3.93e-15 SMART
TUDOR 352 410 2.79e-6 SMART
low complexity region 429 434 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199318
Predicted Effect probably benign
Transcript: ENSMUST00000199678
AA Change: T139S

PolyPhen 2 Score 0.229 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143080
Gene: ENSMUSG00000028141
AA Change: T139S

DomainStartEndE-ValueType
low complexity region 23 41 N/A INTRINSIC
Pfam:ODC_AZ 90 186 1.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203883
AA Change: T94S

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000145484
Gene: ENSMUSG00000028141
AA Change: T94S

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:ODC_AZ 91 189 4.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204548
SMART Domains Protein: ENSMUSP00000145079
Gene: ENSMUSG00000028141

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204913
SMART Domains Protein: ENSMUSP00000145113
Gene: ENSMUSG00000028141

DomainStartEndE-ValueType
low complexity region 71 89 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000204980
AA Change: T17S
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the ornithine decarboxylase antizyme family, which plays a role in cell growth and proliferation by regulating intracellular polyamine levels. Expression of antizymes requires +1 ribosomal frameshifting, which is enhanced by high levels of polyamines. Antizymes in turn bind to and inhibit ornithine decarboxylase (ODC), the key enzyme in polyamine biosynthesis; thus, completing the auto-regulatory circuit. This gene encodes antizyme 3, the third member of the antizyme family. Like antizymes 1 and 2, antizyme 3 inhibits ODC activity and polyamine uptake; however, it does not stimulate ODC degradation. Also, while antizymes 1 and 2 have broad tissue distribution, expression of antizyme 3 is restricted to haploid germ cells in testis, suggesting a distinct role for this antizyme in spermiogenesis. Antizyme 3 gene knockout studies showed that homozygous mutant male mice were infertile, and indicated the likely role of this antizyme in the formation of a rigid connection between the sperm head and tail during spermatogenesis. This transcript initiates translation from a non-AUG (CUG) codon that is highly conserved among the antizyme 3 orthologs. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male infertility due to detachment of sperm tail and head during sperm maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,573,282 I116N probably damaging Het
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Ap3b1 C A 13: 94,493,699 H821N unknown Het
Apex1 C T 14: 50,926,893 P264S probably benign Het
Arhgap27 T C 11: 103,360,872 Y10C probably damaging Het
Bag6 A G 17: 35,140,302 T208A probably benign Het
Brd4 G T 17: 32,202,449 P771Q probably damaging Het
Capn3 A G 2: 120,477,186 S69G probably benign Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Celsr1 T C 15: 85,916,687 H2519R probably benign Het
Chd8 T A 14: 52,201,698 N48I probably damaging Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Dnhd1 C T 7: 105,704,048 P2803S probably damaging Het
Dusp26 G A 8: 31,094,224 D120N probably damaging Het
Epha6 T C 16: 60,425,356 H160R possibly damaging Het
Erg C T 16: 95,379,163 V215I probably damaging Het
Fam71f1 T C 6: 29,319,374 L59P probably damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gabbr2 T C 4: 46,681,189 D124G probably damaging Het
Gapdh T C 6: 125,162,698 H203R probably damaging Het
Ggnbp2 T C 11: 84,836,677 M42V possibly damaging Het
Hk2 C A 6: 82,728,842 A827S probably benign Het
Hoxa5 T C 6: 52,202,714 E227G probably damaging Het
Itgax C A 7: 128,130,332 H31N possibly damaging Het
Itgax A G 7: 128,147,853 D942G probably benign Het
Kars A T 8: 112,000,197 probably null Het
Lama3 T C 18: 12,513,645 F1739L probably damaging Het
Map2k1 A T 9: 64,205,163 L155Q probably damaging Het
Mcf2l A T 8: 13,017,431 D1013V probably damaging Het
Mocs1 G A 17: 49,435,196 G118S probably damaging Het
Ncam2 T C 16: 81,432,762 S37P probably damaging Het
Nfxl1 A G 5: 72,516,210 probably null Het
Nodal C T 10: 61,423,521 H246Y possibly damaging Het
Nwd1 G A 8: 72,695,322 V999M possibly damaging Het
Olfr1347 T C 7: 6,488,368 probably null Het
Olfr58 A G 9: 19,783,289 D52G probably damaging Het
P3h3 T A 6: 124,845,643 T522S probably benign Het
Pgap1 A G 1: 54,514,893 F457S probably damaging Het
Prkce T C 17: 86,559,301 Y530H probably damaging Het
Ptpn3 A T 4: 57,270,070 C31S probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Serpinb6e T A 13: 33,841,237 N24Y probably damaging Het
Slc4a8 T C 15: 100,811,571 V937A possibly damaging Het
Smgc T A 15: 91,850,627 probably benign Het
Srcap T A 7: 127,549,689 N2027K probably damaging Het
Stra6l T C 4: 45,884,664 Y565H probably benign Het
Tmem262 A G 19: 6,080,638 E62G possibly damaging Het
Tnrc6a T A 7: 123,143,742 probably null Het
Txlnb T C 10: 17,799,309 I70T probably damaging Het
Whrn A T 4: 63,494,686 L25* probably null Het
Zfp326 T A 5: 105,910,231 V412E probably damaging Het
Zfp831 A G 2: 174,645,868 R779G possibly damaging Het
Other mutations in Oaz3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02931:Oaz3 APN 3 94434980 missense probably benign 0.15
PIT4366001:Oaz3 UTSW 3 94433594 missense unknown
PIT4791001:Oaz3 UTSW 3 94433545 missense unknown
R1004:Oaz3 UTSW 3 94435043 missense probably damaging 1.00
R1833:Oaz3 UTSW 3 94436042 unclassified probably benign
R2230:Oaz3 UTSW 3 94434539 missense probably benign 0.21
R2231:Oaz3 UTSW 3 94434539 missense probably benign 0.21
R2232:Oaz3 UTSW 3 94434539 missense probably benign 0.21
R4487:Oaz3 UTSW 3 94435130 unclassified probably null
R4776:Oaz3 UTSW 3 94434998 missense probably benign 0.00
R5502:Oaz3 UTSW 3 94435085 missense probably damaging 1.00
R5930:Oaz3 UTSW 3 94436410 missense possibly damaging 0.89
R6362:Oaz3 UTSW 3 94434988 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAAGCTCTTGTCTGTGTGC -3'
(R):5'- GGTGTGATTTTAGGACAAAATGAGC -3'

Sequencing Primer
(F):5'- CAAGCTCTTGTCTGTGTGCTACTAG -3'
(R):5'- CCTGGAACTCAATTTGTAGATCAGGC -3'
Posted On2018-02-27