Incidental Mutation 'R6212:Stra6l'
ID503488
Institutional Source Beutler Lab
Gene Symbol Stra6l
Ensembl Gene ENSMUSG00000028327
Gene NameSTRA6-like
SynonymsRbpr2, 1300002K09Rik
MMRRC Submission 044345-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6212 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location45848664-45887008 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45884664 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 565 (Y565H)
Ref Sequence ENSEMBL: ENSMUSP00000103412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030011] [ENSMUST00000107782] [ENSMUST00000107783]
Predicted Effect probably benign
Transcript: ENSMUST00000030011
AA Change: Y565H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030011
Gene: ENSMUSG00000028327
AA Change: Y565H

DomainStartEndE-ValueType
Pfam:RBP_receptor 13 602 8.7e-228 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107782
AA Change: Y474H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103411
Gene: ENSMUSG00000028327
AA Change: Y474H

DomainStartEndE-ValueType
Pfam:RBP_receptor 1 512 2.8e-221 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107783
AA Change: Y565H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103412
Gene: ENSMUSG00000028327
AA Change: Y565H

DomainStartEndE-ValueType
Pfam:RBP_receptor 12 603 1e-254 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165478
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,573,282 I116N probably damaging Het
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Ap3b1 C A 13: 94,493,699 H821N unknown Het
Apex1 C T 14: 50,926,893 P264S probably benign Het
Arhgap27 T C 11: 103,360,872 Y10C probably damaging Het
Bag6 A G 17: 35,140,302 T208A probably benign Het
Brd4 G T 17: 32,202,449 P771Q probably damaging Het
Capn3 A G 2: 120,477,186 S69G probably benign Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Celsr1 T C 15: 85,916,687 H2519R probably benign Het
Chd8 T A 14: 52,201,698 N48I probably damaging Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Dnhd1 C T 7: 105,704,048 P2803S probably damaging Het
Dusp26 G A 8: 31,094,224 D120N probably damaging Het
Epha6 T C 16: 60,425,356 H160R possibly damaging Het
Erg C T 16: 95,379,163 V215I probably damaging Het
Fam71f1 T C 6: 29,319,374 L59P probably damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gabbr2 T C 4: 46,681,189 D124G probably damaging Het
Gapdh T C 6: 125,162,698 H203R probably damaging Het
Ggnbp2 T C 11: 84,836,677 M42V possibly damaging Het
Hk2 C A 6: 82,728,842 A827S probably benign Het
Hoxa5 T C 6: 52,202,714 E227G probably damaging Het
Itgax C A 7: 128,130,332 H31N possibly damaging Het
Itgax A G 7: 128,147,853 D942G probably benign Het
Kars A T 8: 112,000,197 probably null Het
Lama3 T C 18: 12,513,645 F1739L probably damaging Het
Map2k1 A T 9: 64,205,163 L155Q probably damaging Het
Mcf2l A T 8: 13,017,431 D1013V probably damaging Het
Mocs1 G A 17: 49,435,196 G118S probably damaging Het
Ncam2 T C 16: 81,432,762 S37P probably damaging Het
Nfxl1 A G 5: 72,516,210 probably null Het
Nodal C T 10: 61,423,521 H246Y possibly damaging Het
Nwd1 G A 8: 72,695,322 V999M possibly damaging Het
Oaz3 T A 3: 94,435,068 T139S probably benign Het
Olfr1347 T C 7: 6,488,368 probably null Het
Olfr58 A G 9: 19,783,289 D52G probably damaging Het
P3h3 T A 6: 124,845,643 T522S probably benign Het
Pgap1 A G 1: 54,514,893 F457S probably damaging Het
Prkce T C 17: 86,559,301 Y530H probably damaging Het
Ptpn3 A T 4: 57,270,070 C31S probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Serpinb6e T A 13: 33,841,237 N24Y probably damaging Het
Slc4a8 T C 15: 100,811,571 V937A possibly damaging Het
Smgc T A 15: 91,850,627 probably benign Het
Srcap T A 7: 127,549,689 N2027K probably damaging Het
Tmem262 A G 19: 6,080,638 E62G possibly damaging Het
Tnrc6a T A 7: 123,143,742 probably null Het
Txlnb T C 10: 17,799,309 I70T probably damaging Het
Whrn A T 4: 63,494,686 L25* probably null Het
Zfp326 T A 5: 105,910,231 V412E probably damaging Het
Zfp831 A G 2: 174,645,868 R779G possibly damaging Het
Other mutations in Stra6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Stra6l APN 4 45864864 splice site probably null
IGL02343:Stra6l APN 4 45869588 missense probably damaging 0.99
IGL02710:Stra6l APN 4 45882728 missense possibly damaging 0.72
IGL02880:Stra6l APN 4 45885278 missense possibly damaging 0.70
IGL03034:Stra6l APN 4 45885392 missense probably benign 0.41
IGL03163:Stra6l APN 4 45881455 missense probably benign 0.03
IGL03355:Stra6l APN 4 45873689 missense probably benign 0.16
K2124:Stra6l UTSW 4 45870770 splice site probably benign
R0800:Stra6l UTSW 4 45882797 missense probably benign 0.29
R1171:Stra6l UTSW 4 45864982 missense probably benign
R1931:Stra6l UTSW 4 45882698 nonsense probably null
R1982:Stra6l UTSW 4 45867237 nonsense probably null
R2331:Stra6l UTSW 4 45858224 critical splice donor site probably null
R4691:Stra6l UTSW 4 45882851 missense probably benign 0.39
R4846:Stra6l UTSW 4 45873682 missense possibly damaging 0.76
R5175:Stra6l UTSW 4 45870860 missense probably benign 0.01
R5633:Stra6l UTSW 4 45881455 missense probably benign 0.00
R6517:Stra6l UTSW 4 45879473 missense probably benign
R6534:Stra6l UTSW 4 45860041 splice site probably null
R6584:Stra6l UTSW 4 45869635 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGTACTAATTGGGCGGTAATGG -3'
(R):5'- GTAGGTAAGCCAGTCTGCAG -3'

Sequencing Primer
(F):5'- GTAATGGGAGGTGCAGCC -3'
(R):5'- CCACGCAGCTTGAATGATG -3'
Posted On2018-02-27