Incidental Mutation 'R6212:Whrn'
ID503491
Institutional Source Beutler Lab
Gene Symbol Whrn
Ensembl Gene ENSMUSG00000039137
Gene Namewhirlin
SynonymsC430046P22Rik, Dfnb31, wi, 1110035G07Rik
MMRRC Submission 044345-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6212 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location63414910-63495991 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 63494686 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 25 (L25*)
Ref Sequence ENSEMBL: ENSMUSP00000119280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063650] [ENSMUST00000063672] [ENSMUST00000084510] [ENSMUST00000095037] [ENSMUST00000095038] [ENSMUST00000102867] [ENSMUST00000107393] [ENSMUST00000119294] [ENSMUST00000133425]
Predicted Effect probably null
Transcript: ENSMUST00000063650
AA Change: L183*
SMART Domains Protein: ENSMUSP00000069664
Gene: ENSMUSG00000039137
AA Change: L183*

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
PDZ 824 904 2.63e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000063672
AA Change: L183*
SMART Domains Protein: ENSMUSP00000065838
Gene: ENSMUSG00000039137
AA Change: L183*

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000084510
AA Change: L183*
SMART Domains Protein: ENSMUSP00000081557
Gene: ENSMUSG00000039137
AA Change: L183*

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 640 653 N/A INTRINSIC
PDZ 835 915 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095037
SMART Domains Protein: ENSMUSP00000092647
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 126 139 N/A INTRINSIC
PDZ 321 401 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095038
SMART Domains Protein: ENSMUSP00000092648
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 80 99 N/A INTRINSIC
low complexity region 198 211 N/A INTRINSIC
PDZ 393 473 2.63e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102867
AA Change: L183*
SMART Domains Protein: ENSMUSP00000099931
Gene: ENSMUSG00000039137
AA Change: L183*

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
PDZ 823 903 2.63e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107393
AA Change: L183*
SMART Domains Protein: ENSMUSP00000103016
Gene: ENSMUSG00000039137
AA Change: L183*

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 1.7e-23 SMART
PDZ 289 361 1.8e-21 SMART
low complexity region 526 545 N/A INTRINSIC
low complexity region 633 646 N/A INTRINSIC
PDZ 828 908 1.3e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119294
SMART Domains Protein: ENSMUSP00000114030
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 80 99 N/A INTRINSIC
low complexity region 187 200 N/A INTRINSIC
PDZ 382 462 2.63e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124016
Predicted Effect probably null
Transcript: ENSMUST00000133425
AA Change: L25*
SMART Domains Protein: ENSMUSP00000119280
Gene: ENSMUSG00000039137
AA Change: L25*

DomainStartEndE-ValueType
PDZ 1 65 6.42e-13 SMART
internal_repeat_1 139 164 3.88e-7 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140720
Meta Mutation Damage Score 0.5984 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: This gene encodes a protein required for elongation and actin polymerization in the hair cell stereocilia. The encoded protein is localized to the cytoplasm and co-localizes with the growing end of actin filaments. Mutations in this gene have been linked to deafness. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]
PHENOTYPE: Spontaneous mutants lacking both isoforms show short stereocilia, severe deafness and vestibular deficits. Targeted homozygotes lacking the long form show altered OHC stereocilia bundles but a milder phenotype with normal stereocilia in IHCs and a subset of vestibular HCs and no vestibular deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,573,282 I116N probably damaging Het
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Ap3b1 C A 13: 94,493,699 H821N unknown Het
Apex1 C T 14: 50,926,893 P264S probably benign Het
Arhgap27 T C 11: 103,360,872 Y10C probably damaging Het
Bag6 A G 17: 35,140,302 T208A probably benign Het
Brd4 G T 17: 32,202,449 P771Q probably damaging Het
Capn3 A G 2: 120,477,186 S69G probably benign Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Celsr1 T C 15: 85,916,687 H2519R probably benign Het
Chd8 T A 14: 52,201,698 N48I probably damaging Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Dnhd1 C T 7: 105,704,048 P2803S probably damaging Het
Dusp26 G A 8: 31,094,224 D120N probably damaging Het
Epha6 T C 16: 60,425,356 H160R possibly damaging Het
Erg C T 16: 95,379,163 V215I probably damaging Het
Fam71f1 T C 6: 29,319,374 L59P probably damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gabbr2 T C 4: 46,681,189 D124G probably damaging Het
Gapdh T C 6: 125,162,698 H203R probably damaging Het
Ggnbp2 T C 11: 84,836,677 M42V possibly damaging Het
Hk2 C A 6: 82,728,842 A827S probably benign Het
Hoxa5 T C 6: 52,202,714 E227G probably damaging Het
Itgax C A 7: 128,130,332 H31N possibly damaging Het
Itgax A G 7: 128,147,853 D942G probably benign Het
Kars A T 8: 112,000,197 probably null Het
Lama3 T C 18: 12,513,645 F1739L probably damaging Het
Map2k1 A T 9: 64,205,163 L155Q probably damaging Het
Mcf2l A T 8: 13,017,431 D1013V probably damaging Het
Mocs1 G A 17: 49,435,196 G118S probably damaging Het
Ncam2 T C 16: 81,432,762 S37P probably damaging Het
Nfxl1 A G 5: 72,516,210 probably null Het
Nodal C T 10: 61,423,521 H246Y possibly damaging Het
Nwd1 G A 8: 72,695,322 V999M possibly damaging Het
Oaz3 T A 3: 94,435,068 T139S probably benign Het
Olfr1347 T C 7: 6,488,368 probably null Het
Olfr58 A G 9: 19,783,289 D52G probably damaging Het
P3h3 T A 6: 124,845,643 T522S probably benign Het
Pgap1 A G 1: 54,514,893 F457S probably damaging Het
Prkce T C 17: 86,559,301 Y530H probably damaging Het
Ptpn3 A T 4: 57,270,070 C31S probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Serpinb6e T A 13: 33,841,237 N24Y probably damaging Het
Slc4a8 T C 15: 100,811,571 V937A possibly damaging Het
Smgc T A 15: 91,850,627 probably benign Het
Srcap T A 7: 127,549,689 N2027K probably damaging Het
Stra6l T C 4: 45,884,664 Y565H probably benign Het
Tmem262 A G 19: 6,080,638 E62G possibly damaging Het
Tnrc6a T A 7: 123,143,742 probably null Het
Txlnb T C 10: 17,799,309 I70T probably damaging Het
Zfp326 T A 5: 105,910,231 V412E probably damaging Het
Zfp831 A G 2: 174,645,868 R779G possibly damaging Het
Other mutations in Whrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01588:Whrn APN 4 63472778 missense probably damaging 1.00
IGL01643:Whrn APN 4 63416435 missense possibly damaging 0.79
IGL02065:Whrn APN 4 63418585 missense possibly damaging 0.52
IGL02119:Whrn APN 4 63435487 missense probably damaging 0.99
IGL02589:Whrn APN 4 63418097 nonsense probably null
IGL02638:Whrn APN 4 63419472 missense possibly damaging 0.47
IGL02865:Whrn APN 4 63415492 missense probably benign 0.08
IGL02934:Whrn APN 4 63416105 missense probably damaging 1.00
IGL03372:Whrn APN 4 63418618 missense probably damaging 0.96
R0090:Whrn UTSW 4 63432732 missense possibly damaging 0.79
R0592:Whrn UTSW 4 63415567 missense probably damaging 1.00
R0631:Whrn UTSW 4 63419489 missense probably damaging 1.00
R1916:Whrn UTSW 4 63494732 missense probably damaging 1.00
R1933:Whrn UTSW 4 63415639 nonsense probably null
R1958:Whrn UTSW 4 63435429 missense possibly damaging 0.62
R2255:Whrn UTSW 4 63418148 missense possibly damaging 0.92
R2513:Whrn UTSW 4 63435412 missense probably benign 0.22
R3699:Whrn UTSW 4 63461412 splice site probably benign
R3919:Whrn UTSW 4 63495184 nonsense probably null
R4016:Whrn UTSW 4 63415639 nonsense probably null
R4241:Whrn UTSW 4 63432973 unclassified probably benign
R4517:Whrn UTSW 4 63461280 critical splice donor site probably null
R4739:Whrn UTSW 4 63418165 missense probably damaging 1.00
R5207:Whrn UTSW 4 63432714 missense probably damaging 1.00
R5281:Whrn UTSW 4 63418427 missense probably benign 0.04
R5307:Whrn UTSW 4 63431843 missense probably benign 0.01
R5463:Whrn UTSW 4 63432816 missense probably benign 0.08
R5663:Whrn UTSW 4 63418448 missense probably damaging 0.98
R5754:Whrn UTSW 4 63416588 missense probably damaging 0.98
R5933:Whrn UTSW 4 63494708 missense probably damaging 1.00
R6380:Whrn UTSW 4 63418592 missense possibly damaging 0.90
R6381:Whrn UTSW 4 63472684 missense probably benign 0.00
R7030:Whrn UTSW 4 63495131 unclassified probably benign
R7350:Whrn UTSW 4 63431959 missense possibly damaging 0.71
R7382:Whrn UTSW 4 63418336 missense probably benign
R7419:Whrn UTSW 4 63416093 missense possibly damaging 0.94
X0009:Whrn UTSW 4 63431911 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAAAATCCGGTCAGGGAGGC -3'
(R):5'- AGCTGCTCTTCGACCAGTAC -3'

Sequencing Primer
(F):5'- CCAGAAAGGTCAGGCGATTTG -3'
(R):5'- TCTTCGACCAGTACACGGC -3'
Posted On2018-02-27