Incidental Mutation 'R6212:Fbxo6'
ID503492
Institutional Source Beutler Lab
Gene Symbol Fbxo6
Ensembl Gene ENSMUSG00000055401
Gene NameF-box protein 6
SynonymsFbx6b, FBG2, Fbs2, Fbxo6b
MMRRC Submission 044345-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R6212 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location148145716-148152140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 148149522 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 39 (I39N)
Ref Sequence ENSEMBL: ENSMUSP00000130188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030858] [ENSMUST00000030860] [ENSMUST00000056965] [ENSMUST00000057907] [ENSMUST00000084129] [ENSMUST00000105705] [ENSMUST00000105706] [ENSMUST00000105707] [ENSMUST00000126615] [ENSMUST00000129253] [ENSMUST00000132083] [ENSMUST00000132698] [ENSMUST00000134261] [ENSMUST00000140049] [ENSMUST00000151246] [ENSMUST00000152098] [ENSMUST00000167160] [ENSMUST00000168503] [ENSMUST00000172472]
Predicted Effect probably damaging
Transcript: ENSMUST00000030858
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030858
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030860
SMART Domains Protein: ENSMUSP00000030860
Gene: ENSMUSG00000029003

DomainStartEndE-ValueType
Pfam:HORMA 12 184 1e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000056965
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062348
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057907
SMART Domains Protein: ENSMUSP00000054022
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 252 2.24e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084129
SMART Domains Protein: ENSMUSP00000081146
Gene: ENSMUSG00000029003

DomainStartEndE-ValueType
Pfam:HORMA 13 167 4.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105705
SMART Domains Protein: ENSMUSP00000101330
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 196 2.79e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105706
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101331
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105707
SMART Domains Protein: ENSMUSP00000101332
Gene: ENSMUSG00000029003

DomainStartEndE-ValueType
Pfam:HORMA 13 171 4.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105708
Predicted Effect probably damaging
Transcript: ENSMUST00000126615
AA Change: I39N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120801
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 237 1.39e-97 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129253
SMART Domains Protein: ENSMUSP00000117013
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 213 1.15e-57 SMART
Predicted Effect unknown
Transcript: ENSMUST00000132083
AA Change: I39N
SMART Domains Protein: ENSMUSP00000120431
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132698
SMART Domains Protein: ENSMUSP00000122774
Gene: ENSMUSG00000029003

DomainStartEndE-ValueType
Pfam:HORMA 12 168 2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134261
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123132
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 228 1.89e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140049
SMART Domains Protein: ENSMUSP00000120481
Gene: ENSMUSG00000029003

DomainStartEndE-ValueType
PDB:4FJO|C 32 107 1e-47 PDB
SCOP:d1go4a_ 32 107 1e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151246
SMART Domains Protein: ENSMUSP00000114571
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 231 1.43e-85 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152098
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121379
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153703
SMART Domains Protein: ENSMUSP00000115937
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBA 1 143 3.11e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167160
SMART Domains Protein: ENSMUSP00000126551
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 252 2.24e-110 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168503
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130188
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172472
SMART Domains Protein: ENSMUSP00000133966
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
Pfam:FBA 68 126 3.4e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183749
Meta Mutation Damage Score 0.25 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class, and its C-terminal region is highly similar to that of rat NFB42 (neural F Box 42 kDa) which may be involved in the control of the cell cycle. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,573,282 I116N probably damaging Het
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Ap3b1 C A 13: 94,493,699 H821N unknown Het
Apex1 C T 14: 50,926,893 P264S probably benign Het
Arhgap27 T C 11: 103,360,872 Y10C probably damaging Het
Bag6 A G 17: 35,140,302 T208A probably benign Het
Brd4 G T 17: 32,202,449 P771Q probably damaging Het
Capn3 A G 2: 120,477,186 S69G probably benign Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Celsr1 T C 15: 85,916,687 H2519R probably benign Het
Chd8 T A 14: 52,201,698 N48I probably damaging Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Dnhd1 C T 7: 105,704,048 P2803S probably damaging Het
Dusp26 G A 8: 31,094,224 D120N probably damaging Het
Epha6 T C 16: 60,425,356 H160R possibly damaging Het
Erg C T 16: 95,379,163 V215I probably damaging Het
Fam71f1 T C 6: 29,319,374 L59P probably damaging Het
Gabbr2 T C 4: 46,681,189 D124G probably damaging Het
Gapdh T C 6: 125,162,698 H203R probably damaging Het
Ggnbp2 T C 11: 84,836,677 M42V possibly damaging Het
Hk2 C A 6: 82,728,842 A827S probably benign Het
Hoxa5 T C 6: 52,202,714 E227G probably damaging Het
Itgax C A 7: 128,130,332 H31N possibly damaging Het
Itgax A G 7: 128,147,853 D942G probably benign Het
Kars A T 8: 112,000,197 probably null Het
Lama3 T C 18: 12,513,645 F1739L probably damaging Het
Map2k1 A T 9: 64,205,163 L155Q probably damaging Het
Mcf2l A T 8: 13,017,431 D1013V probably damaging Het
Mocs1 G A 17: 49,435,196 G118S probably damaging Het
Ncam2 T C 16: 81,432,762 S37P probably damaging Het
Nfxl1 A G 5: 72,516,210 probably null Het
Nodal C T 10: 61,423,521 H246Y possibly damaging Het
Nwd1 G A 8: 72,695,322 V999M possibly damaging Het
Oaz3 T A 3: 94,435,068 T139S probably benign Het
Olfr1347 T C 7: 6,488,368 probably null Het
Olfr58 A G 9: 19,783,289 D52G probably damaging Het
P3h3 T A 6: 124,845,643 T522S probably benign Het
Pgap1 A G 1: 54,514,893 F457S probably damaging Het
Prkce T C 17: 86,559,301 Y530H probably damaging Het
Ptpn3 A T 4: 57,270,070 C31S probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Serpinb6e T A 13: 33,841,237 N24Y probably damaging Het
Slc4a8 T C 15: 100,811,571 V937A possibly damaging Het
Smgc T A 15: 91,850,627 probably benign Het
Srcap T A 7: 127,549,689 N2027K probably damaging Het
Stra6l T C 4: 45,884,664 Y565H probably benign Het
Tmem262 A G 19: 6,080,638 E62G possibly damaging Het
Tnrc6a T A 7: 123,143,742 probably null Het
Txlnb T C 10: 17,799,309 I70T probably damaging Het
Whrn A T 4: 63,494,686 L25* probably null Het
Zfp326 T A 5: 105,910,231 V412E probably damaging Het
Zfp831 A G 2: 174,645,868 R779G possibly damaging Het
Other mutations in Fbxo6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Fbxo6 APN 4 148146143 missense probably damaging 1.00
IGL00940:Fbxo6 APN 4 148146110 missense probably benign 0.05
IGL02996:Fbxo6 APN 4 148146891 missense probably damaging 1.00
IGL03034:Fbxo6 APN 4 148146122 nonsense probably null
R0556:Fbxo6 UTSW 4 148146175 missense probably damaging 1.00
R1475:Fbxo6 UTSW 4 148146110 missense probably benign 0.05
R1482:Fbxo6 UTSW 4 148145984 nonsense probably null
R1986:Fbxo6 UTSW 4 148146095 missense probably damaging 1.00
R3742:Fbxo6 UTSW 4 148149633 unclassified probably benign
R4994:Fbxo6 UTSW 4 148149491 missense probably damaging 0.99
R6102:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6103:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6104:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6105:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6129:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6130:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6220:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6392:Fbxo6 UTSW 4 148146005 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACATTTGTCGTTAGCTAGCGTG -3'
(R):5'- TTCAGGTCCTCAGCTCACTG -3'

Sequencing Primer
(F):5'- TAAAGAAGGCTCCCAGGGCTC -3'
(R):5'- AGGTCCTCAGCTCACTGTCTTC -3'
Posted On2018-02-27