Incidental Mutation 'R6212:Nfxl1'
ID503493
Institutional Source Beutler Lab
Gene Symbol Nfxl1
Ensembl Gene ENSMUSG00000072889
Gene Namenuclear transcription factor, X-box binding-like 1
Synonyms1700012H24Rik, TCF9, D430033A06Rik, LOC381696
MMRRC Submission 044345-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R6212 (G1)
Quality Score219.009
Status Validated
Chromosome5
Chromosomal Location72513301-72559684 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 72516210 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000084467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087216] [ENSMUST00000135318]
Predicted Effect probably null
Transcript: ENSMUST00000087216
SMART Domains Protein: ENSMUSP00000084467
Gene: ENSMUSG00000072889

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 25 64 N/A INTRINSIC
low complexity region 106 125 N/A INTRINSIC
low complexity region 134 142 N/A INTRINSIC
RING 167 226 4.99e-1 SMART
ZnF_NFX 272 290 2.83e-3 SMART
ZnF_NFX 325 344 1.42e-3 SMART
ZnF_NFX 378 397 2.88e-4 SMART
ZnF_NFX 431 450 5.01e-4 SMART
ZnF_NFX 458 479 1.67e2 SMART
ZnF_NFX 483 502 9.71e-2 SMART
ZnF_NFX 510 529 3.49e-3 SMART
ZnF_NFX 567 587 4.56e1 SMART
Pfam:zf-NF-X1 596 608 6.8e-3 PFAM
ZnF_NFX 677 710 4.23e1 SMART
ZnF_NFX 720 738 5.49e-1 SMART
ZnF_NFX 782 801 1.63e-3 SMART
coiled coil region 829 880 N/A INTRINSIC
transmembrane domain 897 914 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135318
SMART Domains Protein: ENSMUSP00000114355
Gene: ENSMUSG00000072889

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 25 64 N/A INTRINSIC
low complexity region 106 125 N/A INTRINSIC
low complexity region 134 142 N/A INTRINSIC
RING 167 226 4.99e-1 SMART
ZnF_NFX 272 290 2.83e-3 SMART
ZnF_NFX 325 344 1.42e-3 SMART
ZnF_NFX 378 397 2.88e-4 SMART
ZnF_NFX 431 450 5.01e-4 SMART
ZnF_NFX 458 479 1.67e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149393
Meta Mutation Damage Score 0.484 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,573,282 I116N probably damaging Het
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Ap3b1 C A 13: 94,493,699 H821N unknown Het
Apex1 C T 14: 50,926,893 P264S probably benign Het
Arhgap27 T C 11: 103,360,872 Y10C probably damaging Het
Bag6 A G 17: 35,140,302 T208A probably benign Het
Brd4 G T 17: 32,202,449 P771Q probably damaging Het
Capn3 A G 2: 120,477,186 S69G probably benign Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Celsr1 T C 15: 85,916,687 H2519R probably benign Het
Chd8 T A 14: 52,201,698 N48I probably damaging Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Dnhd1 C T 7: 105,704,048 P2803S probably damaging Het
Dusp26 G A 8: 31,094,224 D120N probably damaging Het
Epha6 T C 16: 60,425,356 H160R possibly damaging Het
Erg C T 16: 95,379,163 V215I probably damaging Het
Fam71f1 T C 6: 29,319,374 L59P probably damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gabbr2 T C 4: 46,681,189 D124G probably damaging Het
Gapdh T C 6: 125,162,698 H203R probably damaging Het
Ggnbp2 T C 11: 84,836,677 M42V possibly damaging Het
Hk2 C A 6: 82,728,842 A827S probably benign Het
Hoxa5 T C 6: 52,202,714 E227G probably damaging Het
Itgax C A 7: 128,130,332 H31N possibly damaging Het
Itgax A G 7: 128,147,853 D942G probably benign Het
Kars A T 8: 112,000,197 probably null Het
Lama3 T C 18: 12,513,645 F1739L probably damaging Het
Map2k1 A T 9: 64,205,163 L155Q probably damaging Het
Mcf2l A T 8: 13,017,431 D1013V probably damaging Het
Mocs1 G A 17: 49,435,196 G118S probably damaging Het
Ncam2 T C 16: 81,432,762 S37P probably damaging Het
Nodal C T 10: 61,423,521 H246Y possibly damaging Het
Nwd1 G A 8: 72,695,322 V999M possibly damaging Het
Oaz3 T A 3: 94,435,068 T139S probably benign Het
Olfr1347 T C 7: 6,488,368 probably null Het
Olfr58 A G 9: 19,783,289 D52G probably damaging Het
P3h3 T A 6: 124,845,643 T522S probably benign Het
Pgap1 A G 1: 54,514,893 F457S probably damaging Het
Prkce T C 17: 86,559,301 Y530H probably damaging Het
Ptpn3 A T 4: 57,270,070 C31S probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Serpinb6e T A 13: 33,841,237 N24Y probably damaging Het
Slc4a8 T C 15: 100,811,571 V937A possibly damaging Het
Smgc T A 15: 91,850,627 probably benign Het
Srcap T A 7: 127,549,689 N2027K probably damaging Het
Stra6l T C 4: 45,884,664 Y565H probably benign Het
Tmem262 A G 19: 6,080,638 E62G possibly damaging Het
Tnrc6a T A 7: 123,143,742 probably null Het
Txlnb T C 10: 17,799,309 I70T probably damaging Het
Whrn A T 4: 63,494,686 L25* probably null Het
Zfp326 T A 5: 105,910,231 V412E probably damaging Het
Zfp831 A G 2: 174,645,868 R779G possibly damaging Het
Other mutations in Nfxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01094:Nfxl1 APN 5 72550428 splice site probably benign
IGL01716:Nfxl1 APN 5 72540934 missense probably damaging 1.00
IGL02592:Nfxl1 APN 5 72514229 missense probably benign 0.25
IGL03083:Nfxl1 APN 5 72540662 splice site probably benign
FR4548:Nfxl1 UTSW 5 72559115 small insertion probably benign
FR4737:Nfxl1 UTSW 5 72559121 small insertion probably benign
R0478:Nfxl1 UTSW 5 72524645 critical splice donor site probably null
R0725:Nfxl1 UTSW 5 72559130 missense probably benign
R1374:Nfxl1 UTSW 5 72524145 missense probably benign 0.04
R1616:Nfxl1 UTSW 5 72529037 missense probably benign 0.01
R1752:Nfxl1 UTSW 5 72540875 missense probably damaging 1.00
R2108:Nfxl1 UTSW 5 72514332 critical splice acceptor site probably null
R3081:Nfxl1 UTSW 5 72529035 missense possibly damaging 0.92
R3693:Nfxl1 UTSW 5 72540611 missense probably damaging 0.99
R3725:Nfxl1 UTSW 5 72517062 missense probably damaging 1.00
R4660:Nfxl1 UTSW 5 72552668 missense probably damaging 1.00
R5058:Nfxl1 UTSW 5 72556239 missense probably benign 0.03
R5406:Nfxl1 UTSW 5 72556198 missense possibly damaging 0.92
R5447:Nfxl1 UTSW 5 72529169 missense probably benign 0.01
R5634:Nfxl1 UTSW 5 72529490 missense probably damaging 1.00
R5831:Nfxl1 UTSW 5 72522197 missense probably benign
R5910:Nfxl1 UTSW 5 72540365 missense probably benign 0.05
R6086:Nfxl1 UTSW 5 72541019 missense probably benign 0.39
R6091:Nfxl1 UTSW 5 72514190 missense probably benign 0.00
R6501:Nfxl1 UTSW 5 72528509 unclassified probably null
R6521:Nfxl1 UTSW 5 72540308 unclassified probably null
R7283:Nfxl1 UTSW 5 72529050 missense probably benign
R7426:Nfxl1 UTSW 5 72524174 nonsense probably null
R7480:Nfxl1 UTSW 5 72559252 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAAGACCAGTCTGCCCATC -3'
(R):5'- TCTCCAATGTGAGATTGCCAGAAG -3'

Sequencing Primer
(F):5'- TATGGAGAAGTCTGCCCATCC -3'
(R):5'- AGATTGCCAGAAGTTGCTATGG -3'
Posted On2018-02-27