Incidental Mutation 'R6212:Gapdh'
ID503499
Institutional Source Beutler Lab
Gene Symbol Gapdh
Ensembl Gene ENSMUSG00000057666
Gene Nameglyceraldehyde-3-phosphate dehydrogenase
SynonymsGapd, Gapd
MMRRC Submission 044345-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6212 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location125161715-125166467 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125162698 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 203 (H203R)
Ref Sequence ENSEMBL: ENSMUSP00000113942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073605] [ENSMUST00000117675] [ENSMUST00000117757] [ENSMUST00000118875] [ENSMUST00000119527] [ENSMUST00000144364] [ENSMUST00000182052] [ENSMUST00000182277] [ENSMUST00000183272]
Predicted Effect probably benign
Transcript: ENSMUST00000073605
AA Change: H177R

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000073289
Gene: ENSMUSG00000057666
AA Change: H177R

DomainStartEndE-ValueType
Gp_dh_N 2 143 4.2e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117675
SMART Domains Protein: ENSMUSP00000113088
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
coiled coil region 190 242 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 381 392 N/A INTRINSIC
PDB:1GK4|F 393 459 6e-7 PDB
low complexity region 474 497 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117757
AA Change: H203R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113942
Gene: ENSMUSG00000057666
AA Change: H203R

DomainStartEndE-ValueType
Gp_dh_N 2 150 7.33e-109 SMART
Pfam:Gp_dh_C 155 312 5.2e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118875
AA Change: H177R

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113213
Gene: ENSMUSG00000057666
AA Change: H177R

DomainStartEndE-ValueType
Gp_dh_N 2 150 7.33e-109 SMART
Pfam:Gp_dh_C 155 312 7.4e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119527
SMART Domains Protein: ENSMUSP00000113376
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
coiled coil region 190 242 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
low complexity region 378 389 N/A INTRINSIC
PDB:1GK4|F 390 456 6e-7 PDB
low complexity region 471 494 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144205
Predicted Effect probably benign
Transcript: ENSMUST00000144364
SMART Domains Protein: ENSMUSP00000116701
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
coiled coil region 190 242 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147954
Predicted Effect probably benign
Transcript: ENSMUST00000148835
SMART Domains Protein: ENSMUSP00000115080
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
Filament 34 348 4.99e-2 SMART
low complexity region 356 379 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150474
Predicted Effect probably benign
Transcript: ENSMUST00000182052
SMART Domains Protein: ENSMUSP00000138403
Gene: ENSMUSG00000057666

DomainStartEndE-ValueType
Gp_dh_N 1 55 2.96e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182115
Predicted Effect probably benign
Transcript: ENSMUST00000182277
SMART Domains Protein: ENSMUSP00000138295
Gene: ENSMUSG00000057666

DomainStartEndE-ValueType
Gp_dh_N 2 57 2.75e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182670
Predicted Effect possibly damaging
Transcript: ENSMUST00000183272
AA Change: H134R

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138508
Gene: ENSMUSG00000057666
AA Change: H134R

DomainStartEndE-ValueType
Gp_dh_N 2 107 7.93e-64 SMART
Pfam:Gp_dh_C 112 269 3e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192506
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: This gene encodes a member of the glyceraldehyde-3-phosphate dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein was originally identified as a key glycolytic enzyme that converts D-glyceraldehyde 3-phosphate (G3P) into 3-phospho-D-glyceroyl phosphate. Subsequent studies have assigned a variety of additional functions to the protein including nitrosylation of nuclear proteins, the regulation of mRNA stability, and acting as a transferrin receptor on the cell surface of macrophage. Alternative splicing results in multiple transcript variants. Many pseudogenes similar to this locus are found throughout the mouse genome. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mutant heterozygotes show reduced enzyme levels. The currently known mutant allels are homozygous lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,573,282 I116N probably damaging Het
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Ap3b1 C A 13: 94,493,699 H821N unknown Het
Apex1 C T 14: 50,926,893 P264S probably benign Het
Arhgap27 T C 11: 103,360,872 Y10C probably damaging Het
Bag6 A G 17: 35,140,302 T208A probably benign Het
Brd4 G T 17: 32,202,449 P771Q probably damaging Het
Capn3 A G 2: 120,477,186 S69G probably benign Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Celsr1 T C 15: 85,916,687 H2519R probably benign Het
Chd8 T A 14: 52,201,698 N48I probably damaging Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Dnhd1 C T 7: 105,704,048 P2803S probably damaging Het
Dusp26 G A 8: 31,094,224 D120N probably damaging Het
Epha6 T C 16: 60,425,356 H160R possibly damaging Het
Erg C T 16: 95,379,163 V215I probably damaging Het
Fam71f1 T C 6: 29,319,374 L59P probably damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gabbr2 T C 4: 46,681,189 D124G probably damaging Het
Ggnbp2 T C 11: 84,836,677 M42V possibly damaging Het
Hk2 C A 6: 82,728,842 A827S probably benign Het
Hoxa5 T C 6: 52,202,714 E227G probably damaging Het
Itgax C A 7: 128,130,332 H31N possibly damaging Het
Itgax A G 7: 128,147,853 D942G probably benign Het
Kars A T 8: 112,000,197 probably null Het
Lama3 T C 18: 12,513,645 F1739L probably damaging Het
Map2k1 A T 9: 64,205,163 L155Q probably damaging Het
Mcf2l A T 8: 13,017,431 D1013V probably damaging Het
Mocs1 G A 17: 49,435,196 G118S probably damaging Het
Ncam2 T C 16: 81,432,762 S37P probably damaging Het
Nfxl1 A G 5: 72,516,210 probably null Het
Nodal C T 10: 61,423,521 H246Y possibly damaging Het
Nwd1 G A 8: 72,695,322 V999M possibly damaging Het
Oaz3 T A 3: 94,435,068 T139S probably benign Het
Olfr1347 T C 7: 6,488,368 probably null Het
Olfr58 A G 9: 19,783,289 D52G probably damaging Het
P3h3 T A 6: 124,845,643 T522S probably benign Het
Pgap1 A G 1: 54,514,893 F457S probably damaging Het
Prkce T C 17: 86,559,301 Y530H probably damaging Het
Ptpn3 A T 4: 57,270,070 C31S probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Serpinb6e T A 13: 33,841,237 N24Y probably damaging Het
Slc4a8 T C 15: 100,811,571 V937A possibly damaging Het
Smgc T A 15: 91,850,627 probably benign Het
Srcap T A 7: 127,549,689 N2027K probably damaging Het
Stra6l T C 4: 45,884,664 Y565H probably benign Het
Tmem262 A G 19: 6,080,638 E62G possibly damaging Het
Tnrc6a T A 7: 123,143,742 probably null Het
Txlnb T C 10: 17,799,309 I70T probably damaging Het
Whrn A T 4: 63,494,686 L25* probably null Het
Zfp326 T A 5: 105,910,231 V412E probably damaging Het
Zfp831 A G 2: 174,645,868 R779G possibly damaging Het
Other mutations in Gapdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Gapdh APN 6 125162507 missense probably damaging 0.99
R2203:Gapdh UTSW 6 125162606 missense probably benign 0.18
R3195:Gapdh UTSW 6 125162620 missense possibly damaging 0.94
R4181:Gapdh UTSW 6 125165234 intron probably benign
R4480:Gapdh UTSW 6 125163182 missense possibly damaging 0.55
R5934:Gapdh UTSW 6 125162701 missense probably damaging 0.98
R6019:Gapdh UTSW 6 125163033 nonsense probably null
R6034:Gapdh UTSW 6 125165298 missense probably benign 0.25
R6776:Gapdh UTSW 6 125162273 missense probably damaging 1.00
R6928:Gapdh UTSW 6 125162671 missense probably damaging 1.00
R7188:Gapdh UTSW 6 125165440 intron probably benign
R7330:Gapdh UTSW 6 125162937 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CATACAGGTTTCTCCAGGCG -3'
(R):5'- GACAACTTTGGCATTGTGGAAGG -3'

Sequencing Primer
(F):5'- TCCACGACGGACACATTGG -3'
(R):5'- AAGGGCTCATGGTATGTAGGC -3'
Posted On2018-02-27