Incidental Mutation 'R6212:Acsm2'
ID503503
Institutional Source Beutler Lab
Gene Symbol Acsm2
Ensembl Gene ENSMUSG00000030945
Gene Nameacyl-CoA synthetase medium-chain family member 2
Synonyms
MMRRC Submission 044345-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6212 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location119554340-119600690 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119573282 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 116 (I116N)
Ref Sequence ENSEMBL: ENSMUSP00000115048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084647] [ENSMUST00000098084] [ENSMUST00000130583] [ENSMUST00000167935]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084647
AA Change: I116N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000081697
Gene: ENSMUSG00000030945
AA Change: I116N

DomainStartEndE-ValueType
Pfam:AMP-binding 57 470 8.9e-79 PFAM
Pfam:AMP-binding_C 478 558 3.2e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000098084
AA Change: I141N

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095690
Gene: ENSMUSG00000030945
AA Change: I141N

DomainStartEndE-ValueType
Pfam:AMP-binding 82 495 9.7e-71 PFAM
Pfam:AMP-binding_C 503 583 5.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130583
AA Change: I116N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115048
Gene: ENSMUSG00000030945
AA Change: I116N

DomainStartEndE-ValueType
Pfam:AMP-binding 57 145 6.7e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000167935
AA Change: I116N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126670
Gene: ENSMUSG00000030945
AA Change: I116N

DomainStartEndE-ValueType
Pfam:AMP-binding 57 470 9.1e-79 PFAM
Pfam:AMP-binding_C 483 563 3.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209069
Meta Mutation Damage Score 0.0252 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Ap3b1 C A 13: 94,493,699 H821N unknown Het
Apex1 C T 14: 50,926,893 P264S probably benign Het
Arhgap27 T C 11: 103,360,872 Y10C probably damaging Het
Bag6 A G 17: 35,140,302 T208A probably benign Het
Brd4 G T 17: 32,202,449 P771Q probably damaging Het
Capn3 A G 2: 120,477,186 S69G probably benign Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Celsr1 T C 15: 85,916,687 H2519R probably benign Het
Chd8 T A 14: 52,201,698 N48I probably damaging Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Dnhd1 C T 7: 105,704,048 P2803S probably damaging Het
Dusp26 G A 8: 31,094,224 D120N probably damaging Het
Epha6 T C 16: 60,425,356 H160R possibly damaging Het
Erg C T 16: 95,379,163 V215I probably damaging Het
Fam71f1 T C 6: 29,319,374 L59P probably damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gabbr2 T C 4: 46,681,189 D124G probably damaging Het
Gapdh T C 6: 125,162,698 H203R probably damaging Het
Ggnbp2 T C 11: 84,836,677 M42V possibly damaging Het
Hk2 C A 6: 82,728,842 A827S probably benign Het
Hoxa5 T C 6: 52,202,714 E227G probably damaging Het
Itgax C A 7: 128,130,332 H31N possibly damaging Het
Itgax A G 7: 128,147,853 D942G probably benign Het
Kars A T 8: 112,000,197 probably null Het
Lama3 T C 18: 12,513,645 F1739L probably damaging Het
Map2k1 A T 9: 64,205,163 L155Q probably damaging Het
Mcf2l A T 8: 13,017,431 D1013V probably damaging Het
Mocs1 G A 17: 49,435,196 G118S probably damaging Het
Ncam2 T C 16: 81,432,762 S37P probably damaging Het
Nfxl1 A G 5: 72,516,210 probably null Het
Nodal C T 10: 61,423,521 H246Y possibly damaging Het
Nwd1 G A 8: 72,695,322 V999M possibly damaging Het
Oaz3 T A 3: 94,435,068 T139S probably benign Het
Olfr1347 T C 7: 6,488,368 probably null Het
Olfr58 A G 9: 19,783,289 D52G probably damaging Het
P3h3 T A 6: 124,845,643 T522S probably benign Het
Pgap1 A G 1: 54,514,893 F457S probably damaging Het
Prkce T C 17: 86,559,301 Y530H probably damaging Het
Ptpn3 A T 4: 57,270,070 C31S probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Serpinb6e T A 13: 33,841,237 N24Y probably damaging Het
Slc4a8 T C 15: 100,811,571 V937A possibly damaging Het
Smgc T A 15: 91,850,627 probably benign Het
Srcap T A 7: 127,549,689 N2027K probably damaging Het
Stra6l T C 4: 45,884,664 Y565H probably benign Het
Tmem262 A G 19: 6,080,638 E62G possibly damaging Het
Tnrc6a T A 7: 123,143,742 probably null Het
Txlnb T C 10: 17,799,309 I70T probably damaging Het
Whrn A T 4: 63,494,686 L25* probably null Het
Zfp326 T A 5: 105,910,231 V412E probably damaging Het
Zfp831 A G 2: 174,645,868 R779G possibly damaging Het
Other mutations in Acsm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Acsm2 APN 7 119573168 missense probably damaging 1.00
IGL00930:Acsm2 APN 7 119592310 missense possibly damaging 0.91
IGL01472:Acsm2 APN 7 119554536 critical splice donor site probably null
IGL01927:Acsm2 APN 7 119578212 missense possibly damaging 0.75
IGL02550:Acsm2 APN 7 119573284 missense probably damaging 1.00
IGL02551:Acsm2 APN 7 119573284 missense probably damaging 1.00
IGL02818:Acsm2 APN 7 119573581 intron probably null
IGL03064:Acsm2 APN 7 119575641 missense probably damaging 0.98
PIT4469001:Acsm2 UTSW 7 119578185 missense possibly damaging 0.51
R0395:Acsm2 UTSW 7 119575746 missense probably damaging 1.00
R0416:Acsm2 UTSW 7 119563556 missense probably benign 0.00
R0783:Acsm2 UTSW 7 119573117 missense probably damaging 1.00
R1252:Acsm2 UTSW 7 119573245 missense probably benign 0.15
R1432:Acsm2 UTSW 7 119573575 missense possibly damaging 0.83
R1494:Acsm2 UTSW 7 119575632 missense probably damaging 1.00
R1495:Acsm2 UTSW 7 119578126 missense probably damaging 1.00
R1642:Acsm2 UTSW 7 119563637 missense probably damaging 1.00
R1702:Acsm2 UTSW 7 119573564 missense possibly damaging 0.88
R2082:Acsm2 UTSW 7 119580634 missense probably benign 0.00
R2420:Acsm2 UTSW 7 119563634 missense probably damaging 1.00
R3612:Acsm2 UTSW 7 119591330 missense probably damaging 0.97
R4396:Acsm2 UTSW 7 119595920 missense probably damaging 1.00
R4433:Acsm2 UTSW 7 119554509 missense unknown
R4568:Acsm2 UTSW 7 119563517 missense probably benign 0.00
R4718:Acsm2 UTSW 7 119573603 missense probably damaging 0.96
R5025:Acsm2 UTSW 7 119554496 missense unknown
R5497:Acsm2 UTSW 7 119573320 missense possibly damaging 0.69
R5509:Acsm2 UTSW 7 119573617 missense probably damaging 1.00
R5682:Acsm2 UTSW 7 119563551 missense probably benign 0.12
R5941:Acsm2 UTSW 7 119591098 missense probably damaging 1.00
R5956:Acsm2 UTSW 7 119554481 missense unknown
R6129:Acsm2 UTSW 7 119591247 unclassified probably null
R7026:Acsm2 UTSW 7 119592227 missense probably damaging 1.00
R7227:Acsm2 UTSW 7 119591333 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTTTCCTTCAGGCTGGCAAG -3'
(R):5'- TTCTCCAGAGAAGGGCTGTG -3'

Sequencing Primer
(F):5'- CTTCAGGCTGGCAAGAGATCTTC -3'
(R):5'- TGTGCACAGCCATGGGG -3'
Posted On2018-02-27