Incidental Mutation 'R6212:Dusp26'
ID503509
Institutional Source Beutler Lab
Gene Symbol Dusp26
Ensembl Gene ENSMUSG00000039661
Gene Namedual specificity phosphatase 26 (putative)
Synonyms
MMRRC Submission 044345-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6212 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location31089471-31097047 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 31094224 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 120 (D120N)
Ref Sequence ENSEMBL: ENSMUSP00000126397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036631] [ENSMUST00000161713] [ENSMUST00000170204]
Predicted Effect probably damaging
Transcript: ENSMUST00000036631
AA Change: D120N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046794
Gene: ENSMUSG00000039661
AA Change: D120N

DomainStartEndE-ValueType
DSPc 61 204 3.1e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160700
Predicted Effect probably damaging
Transcript: ENSMUST00000161713
AA Change: D120N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124949
Gene: ENSMUSG00000039661
AA Change: D120N

DomainStartEndE-ValueType
DSPc 61 204 3.1e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162551
Predicted Effect probably damaging
Transcript: ENSMUST00000170204
AA Change: D120N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126397
Gene: ENSMUSG00000039661
AA Change: D120N

DomainStartEndE-ValueType
DSPc 61 204 3.1e-39 SMART
Meta Mutation Damage Score 0.416 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tyrosine phosphatase family of proteins and exhibits dual specificity by dephosphorylating tyrosine as well as serine and threonine residues. This gene has been described as both a tumor suppressor and an oncogene depending on the cellular context. This protein may regulate neuronal proliferation and has been implicated in the progression of glioblastoma through its ability to dephosphorylate the p53 tumor suppressor. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,573,282 I116N probably damaging Het
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Ap3b1 C A 13: 94,493,699 H821N unknown Het
Apex1 C T 14: 50,926,893 P264S probably benign Het
Arhgap27 T C 11: 103,360,872 Y10C probably damaging Het
Bag6 A G 17: 35,140,302 T208A probably benign Het
Brd4 G T 17: 32,202,449 P771Q probably damaging Het
Capn3 A G 2: 120,477,186 S69G probably benign Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Celsr1 T C 15: 85,916,687 H2519R probably benign Het
Chd8 T A 14: 52,201,698 N48I probably damaging Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Dnhd1 C T 7: 105,704,048 P2803S probably damaging Het
Epha6 T C 16: 60,425,356 H160R possibly damaging Het
Erg C T 16: 95,379,163 V215I probably damaging Het
Fam71f1 T C 6: 29,319,374 L59P probably damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gabbr2 T C 4: 46,681,189 D124G probably damaging Het
Gapdh T C 6: 125,162,698 H203R probably damaging Het
Ggnbp2 T C 11: 84,836,677 M42V possibly damaging Het
Hk2 C A 6: 82,728,842 A827S probably benign Het
Hoxa5 T C 6: 52,202,714 E227G probably damaging Het
Itgax C A 7: 128,130,332 H31N possibly damaging Het
Itgax A G 7: 128,147,853 D942G probably benign Het
Kars A T 8: 112,000,197 probably null Het
Lama3 T C 18: 12,513,645 F1739L probably damaging Het
Map2k1 A T 9: 64,205,163 L155Q probably damaging Het
Mcf2l A T 8: 13,017,431 D1013V probably damaging Het
Mocs1 G A 17: 49,435,196 G118S probably damaging Het
Ncam2 T C 16: 81,432,762 S37P probably damaging Het
Nfxl1 A G 5: 72,516,210 probably null Het
Nodal C T 10: 61,423,521 H246Y possibly damaging Het
Nwd1 G A 8: 72,695,322 V999M possibly damaging Het
Oaz3 T A 3: 94,435,068 T139S probably benign Het
Olfr1347 T C 7: 6,488,368 probably null Het
Olfr58 A G 9: 19,783,289 D52G probably damaging Het
P3h3 T A 6: 124,845,643 T522S probably benign Het
Pgap1 A G 1: 54,514,893 F457S probably damaging Het
Prkce T C 17: 86,559,301 Y530H probably damaging Het
Ptpn3 A T 4: 57,270,070 C31S probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Serpinb6e T A 13: 33,841,237 N24Y probably damaging Het
Slc4a8 T C 15: 100,811,571 V937A possibly damaging Het
Smgc T A 15: 91,850,627 probably benign Het
Srcap T A 7: 127,549,689 N2027K probably damaging Het
Stra6l T C 4: 45,884,664 Y565H probably benign Het
Tmem262 A G 19: 6,080,638 E62G possibly damaging Het
Tnrc6a T A 7: 123,143,742 probably null Het
Txlnb T C 10: 17,799,309 I70T probably damaging Het
Whrn A T 4: 63,494,686 L25* probably null Het
Zfp326 T A 5: 105,910,231 V412E probably damaging Het
Zfp831 A G 2: 174,645,868 R779G possibly damaging Het
Other mutations in Dusp26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Dusp26 APN 8 31094108 missense probably benign 0.01
R0037:Dusp26 UTSW 8 31096360 missense unknown
R0394:Dusp26 UTSW 8 31091959 missense probably benign 0.16
R1792:Dusp26 UTSW 8 31091935 missense probably benign 0.01
R4454:Dusp26 UTSW 8 31094144 missense probably damaging 0.99
R4854:Dusp26 UTSW 8 31094137 missense probably damaging 1.00
R5638:Dusp26 UTSW 8 31094141 missense probably damaging 1.00
R6337:Dusp26 UTSW 8 31096297 missense probably damaging 1.00
R7083:Dusp26 UTSW 8 31091719 intron probably benign
Predicted Primers PCR Primer
(F):5'- GTACAGCAGAGGTACACAGCCA -3'
(R):5'- GGTTAAACTTTTGCTCCATCCTTGA -3'

Sequencing Primer
(F):5'- AGCCAAGTTTCCTGGTACCATGG -3'
(R):5'- CGATGGATGAAGTCCGC -3'
Posted On2018-02-27