Incidental Mutation 'R6212:Kars'
ID503511
Institutional Source Beutler Lab
Gene Symbol Kars
Ensembl Gene ENSMUSG00000031948
Gene Namelysyl-tRNA synthetase
SynonymsLysRS, D8Ertd698e, D8Wsu108e
MMRRC Submission 044345-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6212 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location111993443-112011323 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 112000197 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034426] [ENSMUST00000034426] [ENSMUST00000093120] [ENSMUST00000093120] [ENSMUST00000164470] [ENSMUST00000164470]
Predicted Effect probably null
Transcript: ENSMUST00000034426
SMART Domains Protein: ENSMUSP00000034426
Gene: ENSMUSG00000031948

DomainStartEndE-ValueType
coiled coil region 14 53 N/A INTRINSIC
Pfam:tRNA_anti-codon 124 204 2.8e-15 PFAM
Pfam:tRNA-synt_2 220 573 4.9e-93 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000034426
SMART Domains Protein: ENSMUSP00000034426
Gene: ENSMUSG00000031948

DomainStartEndE-ValueType
coiled coil region 14 53 N/A INTRINSIC
Pfam:tRNA_anti-codon 124 204 2.8e-15 PFAM
Pfam:tRNA-synt_2 220 573 4.9e-93 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000093120
SMART Domains Protein: ENSMUSP00000090808
Gene: ENSMUSG00000031948

DomainStartEndE-ValueType
coiled coil region 44 82 N/A INTRINSIC
Pfam:tRNA_anti-codon 153 233 3.6e-17 PFAM
Pfam:tRNA-synt_2 249 601 1.1e-79 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000093120
SMART Domains Protein: ENSMUSP00000090808
Gene: ENSMUSG00000031948

DomainStartEndE-ValueType
coiled coil region 44 82 N/A INTRINSIC
Pfam:tRNA_anti-codon 153 233 3.6e-17 PFAM
Pfam:tRNA-synt_2 249 601 1.1e-79 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000164470
SMART Domains Protein: ENSMUSP00000126268
Gene: ENSMUSG00000031948

DomainStartEndE-ValueType
coiled coil region 44 82 N/A INTRINSIC
Pfam:tRNA_anti-codon 153 233 1.6e-16 PFAM
Pfam:tRNA-synt_2 249 602 1.8e-94 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000164470
SMART Domains Protein: ENSMUSP00000126268
Gene: ENSMUSG00000031948

DomainStartEndE-ValueType
coiled coil region 44 82 N/A INTRINSIC
Pfam:tRNA_anti-codon 153 233 1.6e-16 PFAM
Pfam:tRNA-synt_2 249 602 1.8e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212693
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. Lysyl-tRNA synthetase is a homodimer localized to the cytoplasm which belongs to the class II family of tRNA synthetases. It has been shown to be a target of autoantibodies in the human autoimmune diseases, polymyositis or dermatomyositis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,573,282 I116N probably damaging Het
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Ap3b1 C A 13: 94,493,699 H821N unknown Het
Apex1 C T 14: 50,926,893 P264S probably benign Het
Arhgap27 T C 11: 103,360,872 Y10C probably damaging Het
Bag6 A G 17: 35,140,302 T208A probably benign Het
Brd4 G T 17: 32,202,449 P771Q probably damaging Het
Capn3 A G 2: 120,477,186 S69G probably benign Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Celsr1 T C 15: 85,916,687 H2519R probably benign Het
Chd8 T A 14: 52,201,698 N48I probably damaging Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Dnhd1 C T 7: 105,704,048 P2803S probably damaging Het
Dusp26 G A 8: 31,094,224 D120N probably damaging Het
Epha6 T C 16: 60,425,356 H160R possibly damaging Het
Erg C T 16: 95,379,163 V215I probably damaging Het
Fam71f1 T C 6: 29,319,374 L59P probably damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gabbr2 T C 4: 46,681,189 D124G probably damaging Het
Gapdh T C 6: 125,162,698 H203R probably damaging Het
Ggnbp2 T C 11: 84,836,677 M42V possibly damaging Het
Hk2 C A 6: 82,728,842 A827S probably benign Het
Hoxa5 T C 6: 52,202,714 E227G probably damaging Het
Itgax C A 7: 128,130,332 H31N possibly damaging Het
Itgax A G 7: 128,147,853 D942G probably benign Het
Lama3 T C 18: 12,513,645 F1739L probably damaging Het
Map2k1 A T 9: 64,205,163 L155Q probably damaging Het
Mcf2l A T 8: 13,017,431 D1013V probably damaging Het
Mocs1 G A 17: 49,435,196 G118S probably damaging Het
Ncam2 T C 16: 81,432,762 S37P probably damaging Het
Nfxl1 A G 5: 72,516,210 probably null Het
Nodal C T 10: 61,423,521 H246Y possibly damaging Het
Nwd1 G A 8: 72,695,322 V999M possibly damaging Het
Oaz3 T A 3: 94,435,068 T139S probably benign Het
Olfr1347 T C 7: 6,488,368 probably null Het
Olfr58 A G 9: 19,783,289 D52G probably damaging Het
P3h3 T A 6: 124,845,643 T522S probably benign Het
Pgap1 A G 1: 54,514,893 F457S probably damaging Het
Prkce T C 17: 86,559,301 Y530H probably damaging Het
Ptpn3 A T 4: 57,270,070 C31S probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Serpinb6e T A 13: 33,841,237 N24Y probably damaging Het
Slc4a8 T C 15: 100,811,571 V937A possibly damaging Het
Smgc T A 15: 91,850,627 probably benign Het
Srcap T A 7: 127,549,689 N2027K probably damaging Het
Stra6l T C 4: 45,884,664 Y565H probably benign Het
Tmem262 A G 19: 6,080,638 E62G possibly damaging Het
Tnrc6a T A 7: 123,143,742 probably null Het
Txlnb T C 10: 17,799,309 I70T probably damaging Het
Whrn A T 4: 63,494,686 L25* probably null Het
Zfp326 T A 5: 105,910,231 V412E probably damaging Het
Zfp831 A G 2: 174,645,868 R779G possibly damaging Het
Other mutations in Kars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Kars APN 8 111994974 missense probably benign
IGL02005:Kars APN 8 112000104 nonsense probably null
IGL02439:Kars APN 8 111997636 missense probably benign 0.09
IGL03240:Kars APN 8 112005639 missense probably benign 0.02
IGL03399:Kars APN 8 112008294 missense probably benign 0.25
LCD18:Kars UTSW 8 111993708 critical splice acceptor site probably benign
R0325:Kars UTSW 8 112008216 missense probably benign
R0570:Kars UTSW 8 111994862 critical splice donor site probably null
R1566:Kars UTSW 8 111997658 missense probably benign 0.01
R2023:Kars UTSW 8 112001852 missense probably benign 0.02
R4690:Kars UTSW 8 112002584 missense probably benign
R4839:Kars UTSW 8 112002526 missense possibly damaging 0.75
R4946:Kars UTSW 8 112001720 missense possibly damaging 0.81
R5716:Kars UTSW 8 112003442 critical splice acceptor site probably null
R5882:Kars UTSW 8 112003425 nonsense probably null
R6188:Kars UTSW 8 112008481 critical splice donor site probably null
R6594:Kars UTSW 8 111993667 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CAGCTGCTTCCAAGGACATC -3'
(R):5'- AGCCTGTCAGCACTTACAGTAC -3'

Sequencing Primer
(F):5'- TTCCTGCAGACTGGACTGGTC -3'
(R):5'- CTCTGTAATATAAGGAATGGAGATGC -3'
Posted On2018-02-27