Incidental Mutation 'R6212:Olfr58'
ID503513
Institutional Source Beutler Lab
Gene Symbol Olfr58
Ensembl Gene ENSMUSG00000058659
Gene Nameolfactory receptor 58
SynonymsIG6, MOR146-7P, MOR146-3, GA_x6K02T2PVTD-13523015-13523944
MMRRC Submission 044345-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6212 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location19780283-19785333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19783289 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 52 (D52G)
Ref Sequence ENSEMBL: ENSMUSP00000150309 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000212363
AA Change: D14G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215112
AA Change: D52G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.31 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,573,282 I116N probably damaging Het
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Ap3b1 C A 13: 94,493,699 H821N unknown Het
Apex1 C T 14: 50,926,893 P264S probably benign Het
Arhgap27 T C 11: 103,360,872 Y10C probably damaging Het
Bag6 A G 17: 35,140,302 T208A probably benign Het
Brd4 G T 17: 32,202,449 P771Q probably damaging Het
Capn3 A G 2: 120,477,186 S69G probably benign Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Celsr1 T C 15: 85,916,687 H2519R probably benign Het
Chd8 T A 14: 52,201,698 N48I probably damaging Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Dnhd1 C T 7: 105,704,048 P2803S probably damaging Het
Dusp26 G A 8: 31,094,224 D120N probably damaging Het
Epha6 T C 16: 60,425,356 H160R possibly damaging Het
Erg C T 16: 95,379,163 V215I probably damaging Het
Fam71f1 T C 6: 29,319,374 L59P probably damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gabbr2 T C 4: 46,681,189 D124G probably damaging Het
Gapdh T C 6: 125,162,698 H203R probably damaging Het
Ggnbp2 T C 11: 84,836,677 M42V possibly damaging Het
Hk2 C A 6: 82,728,842 A827S probably benign Het
Hoxa5 T C 6: 52,202,714 E227G probably damaging Het
Itgax C A 7: 128,130,332 H31N possibly damaging Het
Itgax A G 7: 128,147,853 D942G probably benign Het
Kars A T 8: 112,000,197 probably null Het
Lama3 T C 18: 12,513,645 F1739L probably damaging Het
Map2k1 A T 9: 64,205,163 L155Q probably damaging Het
Mcf2l A T 8: 13,017,431 D1013V probably damaging Het
Mocs1 G A 17: 49,435,196 G118S probably damaging Het
Ncam2 T C 16: 81,432,762 S37P probably damaging Het
Nfxl1 A G 5: 72,516,210 probably null Het
Nodal C T 10: 61,423,521 H246Y possibly damaging Het
Nwd1 G A 8: 72,695,322 V999M possibly damaging Het
Oaz3 T A 3: 94,435,068 T139S probably benign Het
Olfr1347 T C 7: 6,488,368 probably null Het
P3h3 T A 6: 124,845,643 T522S probably benign Het
Pgap1 A G 1: 54,514,893 F457S probably damaging Het
Prkce T C 17: 86,559,301 Y530H probably damaging Het
Ptpn3 A T 4: 57,270,070 C31S probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Serpinb6e T A 13: 33,841,237 N24Y probably damaging Het
Slc4a8 T C 15: 100,811,571 V937A possibly damaging Het
Smgc T A 15: 91,850,627 probably benign Het
Srcap T A 7: 127,549,689 N2027K probably damaging Het
Stra6l T C 4: 45,884,664 Y565H probably benign Het
Tmem262 A G 19: 6,080,638 E62G possibly damaging Het
Tnrc6a T A 7: 123,143,742 probably null Het
Txlnb T C 10: 17,799,309 I70T probably damaging Het
Whrn A T 4: 63,494,686 L25* probably null Het
Zfp326 T A 5: 105,910,231 V412E probably damaging Het
Zfp831 A G 2: 174,645,868 R779G possibly damaging Het
Other mutations in Olfr58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01461:Olfr58 APN 9 19783949 unclassified probably null
IGL01815:Olfr58 APN 9 19784015 missense probably damaging 1.00
IGL02408:Olfr58 APN 9 19783415 missense probably benign 0.31
IGL02644:Olfr58 APN 9 19783714 missense probably benign 0.30
IGL03243:Olfr58 APN 9 19783268 missense probably damaging 0.99
R0603:Olfr58 UTSW 9 19783939 missense probably damaging 1.00
R2363:Olfr58 UTSW 9 19783596 missense probably benign 0.00
R2570:Olfr58 UTSW 9 19784009 missense probably damaging 1.00
R3890:Olfr58 UTSW 9 19783715 missense probably benign 0.03
R3892:Olfr58 UTSW 9 19783715 missense probably benign 0.03
R4163:Olfr58 UTSW 9 19783790 missense possibly damaging 0.69
R4610:Olfr58 UTSW 9 19783146 nonsense probably null
R4691:Olfr58 UTSW 9 19783382 missense probably benign 0.33
R4707:Olfr58 UTSW 9 19783300 missense probably damaging 1.00
R4825:Olfr58 UTSW 9 19783576 missense possibly damaging 0.74
R4950:Olfr58 UTSW 9 19783731 missense probably benign
R5185:Olfr58 UTSW 9 19783376 missense probably damaging 1.00
R5202:Olfr58 UTSW 9 19783218 missense possibly damaging 0.46
R5439:Olfr58 UTSW 9 19783865 missense probably damaging 1.00
R5669:Olfr58 UTSW 9 19783757 missense probably benign 0.02
R5672:Olfr58 UTSW 9 19783211 missense possibly damaging 0.92
R6038:Olfr58 UTSW 9 19783562 missense probably benign
R6038:Olfr58 UTSW 9 19783562 missense probably benign
R6415:Olfr58 UTSW 9 19783748 missense probably damaging 1.00
R7385:Olfr58 UTSW 9 19783211 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACTGCTTAGTTCTCTACAATGGTC -3'
(R):5'- TGCCAGTAGAAAGCTGTCC -3'

Sequencing Primer
(F):5'- TTTCTTTTCAAAAGATGTCCTAGCC -3'
(R):5'- TGCCAGTAGAAAGCTGTCCATACAC -3'
Posted On2018-02-27