Incidental Mutation 'R6212:Ccdc13'
ID503515
Institutional Source Beutler Lab
Gene Symbol Ccdc13
Ensembl Gene ENSMUSG00000079235
Gene Namecoiled-coil domain containing 13
Synonyms
MMRRC Submission 044345-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6212 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location121797627-121839461 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 121798909 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000135986] [ENSMUST00000142783] [ENSMUST00000155511]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126851
Predicted Effect probably benign
Transcript: ENSMUST00000135986
SMART Domains Protein: ENSMUSP00000114787
Gene: ENSMUSG00000079235

DomainStartEndE-ValueType
coiled coil region 19 46 N/A INTRINSIC
coiled coil region 70 103 N/A INTRINSIC
coiled coil region 139 178 N/A INTRINSIC
coiled coil region 206 248 N/A INTRINSIC
low complexity region 293 304 N/A INTRINSIC
coiled coil region 323 370 N/A INTRINSIC
coiled coil region 428 458 N/A INTRINSIC
coiled coil region 550 604 N/A INTRINSIC
coiled coil region 648 670 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140929
Predicted Effect unknown
Transcript: ENSMUST00000142783
AA Change: L214P
SMART Domains Protein: ENSMUSP00000130887
Gene: ENSMUSG00000079235
AA Change: L214P

DomainStartEndE-ValueType
coiled coil region 68 122 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155511
Meta Mutation Damage Score 0.0708 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,573,282 I116N probably damaging Het
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Ap3b1 C A 13: 94,493,699 H821N unknown Het
Apex1 C T 14: 50,926,893 P264S probably benign Het
Arhgap27 T C 11: 103,360,872 Y10C probably damaging Het
Bag6 A G 17: 35,140,302 T208A probably benign Het
Brd4 G T 17: 32,202,449 P771Q probably damaging Het
Capn3 A G 2: 120,477,186 S69G probably benign Het
Celsr1 T C 15: 85,916,687 H2519R probably benign Het
Chd8 T A 14: 52,201,698 N48I probably damaging Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Dnhd1 C T 7: 105,704,048 P2803S probably damaging Het
Dusp26 G A 8: 31,094,224 D120N probably damaging Het
Epha6 T C 16: 60,425,356 H160R possibly damaging Het
Erg C T 16: 95,379,163 V215I probably damaging Het
Fam71f1 T C 6: 29,319,374 L59P probably damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gabbr2 T C 4: 46,681,189 D124G probably damaging Het
Gapdh T C 6: 125,162,698 H203R probably damaging Het
Ggnbp2 T C 11: 84,836,677 M42V possibly damaging Het
Hk2 C A 6: 82,728,842 A827S probably benign Het
Hoxa5 T C 6: 52,202,714 E227G probably damaging Het
Itgax C A 7: 128,130,332 H31N possibly damaging Het
Itgax A G 7: 128,147,853 D942G probably benign Het
Kars A T 8: 112,000,197 probably null Het
Lama3 T C 18: 12,513,645 F1739L probably damaging Het
Map2k1 A T 9: 64,205,163 L155Q probably damaging Het
Mcf2l A T 8: 13,017,431 D1013V probably damaging Het
Mocs1 G A 17: 49,435,196 G118S probably damaging Het
Ncam2 T C 16: 81,432,762 S37P probably damaging Het
Nfxl1 A G 5: 72,516,210 probably null Het
Nodal C T 10: 61,423,521 H246Y possibly damaging Het
Nwd1 G A 8: 72,695,322 V999M possibly damaging Het
Oaz3 T A 3: 94,435,068 T139S probably benign Het
Olfr1347 T C 7: 6,488,368 probably null Het
Olfr58 A G 9: 19,783,289 D52G probably damaging Het
P3h3 T A 6: 124,845,643 T522S probably benign Het
Pgap1 A G 1: 54,514,893 F457S probably damaging Het
Prkce T C 17: 86,559,301 Y530H probably damaging Het
Ptpn3 A T 4: 57,270,070 C31S probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Serpinb6e T A 13: 33,841,237 N24Y probably damaging Het
Slc4a8 T C 15: 100,811,571 V937A possibly damaging Het
Smgc T A 15: 91,850,627 probably benign Het
Srcap T A 7: 127,549,689 N2027K probably damaging Het
Stra6l T C 4: 45,884,664 Y565H probably benign Het
Tmem262 A G 19: 6,080,638 E62G possibly damaging Het
Tnrc6a T A 7: 123,143,742 probably null Het
Txlnb T C 10: 17,799,309 I70T probably damaging Het
Whrn A T 4: 63,494,686 L25* probably null Het
Zfp326 T A 5: 105,910,231 V412E probably damaging Het
Zfp831 A G 2: 174,645,868 R779G possibly damaging Het
Other mutations in Ccdc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Ccdc13 APN 9 121810084 splice site probably benign
IGL01306:Ccdc13 APN 9 121827363 missense probably benign 0.37
ANU23:Ccdc13 UTSW 9 121827363 missense probably benign 0.37
R0112:Ccdc13 UTSW 9 121813481 missense probably damaging 0.98
R0144:Ccdc13 UTSW 9 121827351 missense probably damaging 0.98
R0360:Ccdc13 UTSW 9 121798216 missense probably damaging 1.00
R0364:Ccdc13 UTSW 9 121798216 missense probably damaging 1.00
R1441:Ccdc13 UTSW 9 121813449 missense probably benign 0.44
R1674:Ccdc13 UTSW 9 121809142 missense probably damaging 1.00
R1691:Ccdc13 UTSW 9 121825068 splice site probably null
R1710:Ccdc13 UTSW 9 121819581 missense probably damaging 1.00
R3821:Ccdc13 UTSW 9 121831019 missense probably damaging 1.00
R3822:Ccdc13 UTSW 9 121831019 missense probably damaging 1.00
R3962:Ccdc13 UTSW 9 121798939 intron probably benign
R4695:Ccdc13 UTSW 9 121820760 missense probably damaging 1.00
R4758:Ccdc13 UTSW 9 121833734 missense possibly damaging 0.91
R5058:Ccdc13 UTSW 9 121817547 intron probably benign
R5283:Ccdc13 UTSW 9 121808188 missense probably damaging 1.00
R5436:Ccdc13 UTSW 9 121799043 missense probably benign 0.06
R5601:Ccdc13 UTSW 9 121800572 nonsense probably null
R5623:Ccdc13 UTSW 9 121833733 missense probably damaging 0.99
R5653:Ccdc13 UTSW 9 121798787 makesense probably null
R5665:Ccdc13 UTSW 9 121814290 missense probably damaging 0.99
R5975:Ccdc13 UTSW 9 121827235 missense probably benign 0.00
R6213:Ccdc13 UTSW 9 121798909 intron probably benign
R6214:Ccdc13 UTSW 9 121798909 intron probably benign
R6215:Ccdc13 UTSW 9 121798909 intron probably benign
R6222:Ccdc13 UTSW 9 121798909 intron probably benign
R6223:Ccdc13 UTSW 9 121798909 intron probably benign
R6257:Ccdc13 UTSW 9 121798909 intron probably benign
R7053:Ccdc13 UTSW 9 121833838 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCAACTACCCAGATTCCTAGTTTTG -3'
(R):5'- ACACAGCTCTGCGATATGCC -3'

Sequencing Primer
(F):5'- CACTGCTGAGTGCTGACATTACAG -3'
(R):5'- TCTGCGATATGCCCATGGAGTC -3'
Posted On2018-02-27