Incidental Mutation 'R6212:Txlnb'
ID503516
Institutional Source Beutler Lab
Gene Symbol Txlnb
Ensembl Gene ENSMUSG00000039891
Gene Nametaxilin beta
Synonyms2310001N14Rik, Mdp77
MMRRC Submission 044345-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6212 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location17796226-17845665 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17799309 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 70 (I70T)
Ref Sequence ENSEMBL: ENSMUSP00000044936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037964]
Predicted Effect probably damaging
Transcript: ENSMUST00000037964
AA Change: I70T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044936
Gene: ENSMUSG00000039891
AA Change: I70T

DomainStartEndE-ValueType
internal_repeat_2 5 22 2.13e-6 PROSPERO
internal_repeat_1 25 93 4.27e-8 PROSPERO
low complexity region 115 128 N/A INTRINSIC
Pfam:Taxilin 145 454 3.1e-122 PFAM
low complexity region 477 491 N/A INTRINSIC
internal_repeat_2 543 560 2.13e-6 PROSPERO
low complexity region 575 591 N/A INTRINSIC
internal_repeat_1 600 659 4.27e-8 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181428
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,573,282 I116N probably damaging Het
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Ap3b1 C A 13: 94,493,699 H821N unknown Het
Apex1 C T 14: 50,926,893 P264S probably benign Het
Arhgap27 T C 11: 103,360,872 Y10C probably damaging Het
Bag6 A G 17: 35,140,302 T208A probably benign Het
Brd4 G T 17: 32,202,449 P771Q probably damaging Het
Capn3 A G 2: 120,477,186 S69G probably benign Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Celsr1 T C 15: 85,916,687 H2519R probably benign Het
Chd8 T A 14: 52,201,698 N48I probably damaging Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Dnhd1 C T 7: 105,704,048 P2803S probably damaging Het
Dusp26 G A 8: 31,094,224 D120N probably damaging Het
Epha6 T C 16: 60,425,356 H160R possibly damaging Het
Erg C T 16: 95,379,163 V215I probably damaging Het
Fam71f1 T C 6: 29,319,374 L59P probably damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gabbr2 T C 4: 46,681,189 D124G probably damaging Het
Gapdh T C 6: 125,162,698 H203R probably damaging Het
Ggnbp2 T C 11: 84,836,677 M42V possibly damaging Het
Hk2 C A 6: 82,728,842 A827S probably benign Het
Hoxa5 T C 6: 52,202,714 E227G probably damaging Het
Itgax C A 7: 128,130,332 H31N possibly damaging Het
Itgax A G 7: 128,147,853 D942G probably benign Het
Kars A T 8: 112,000,197 probably null Het
Lama3 T C 18: 12,513,645 F1739L probably damaging Het
Map2k1 A T 9: 64,205,163 L155Q probably damaging Het
Mcf2l A T 8: 13,017,431 D1013V probably damaging Het
Mocs1 G A 17: 49,435,196 G118S probably damaging Het
Ncam2 T C 16: 81,432,762 S37P probably damaging Het
Nfxl1 A G 5: 72,516,210 probably null Het
Nodal C T 10: 61,423,521 H246Y possibly damaging Het
Nwd1 G A 8: 72,695,322 V999M possibly damaging Het
Oaz3 T A 3: 94,435,068 T139S probably benign Het
Olfr1347 T C 7: 6,488,368 probably null Het
Olfr58 A G 9: 19,783,289 D52G probably damaging Het
P3h3 T A 6: 124,845,643 T522S probably benign Het
Pgap1 A G 1: 54,514,893 F457S probably damaging Het
Prkce T C 17: 86,559,301 Y530H probably damaging Het
Ptpn3 A T 4: 57,270,070 C31S probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Serpinb6e T A 13: 33,841,237 N24Y probably damaging Het
Slc4a8 T C 15: 100,811,571 V937A possibly damaging Het
Smgc T A 15: 91,850,627 probably benign Het
Srcap T A 7: 127,549,689 N2027K probably damaging Het
Stra6l T C 4: 45,884,664 Y565H probably benign Het
Tmem262 A G 19: 6,080,638 E62G possibly damaging Het
Tnrc6a T A 7: 123,143,742 probably null Het
Whrn A T 4: 63,494,686 L25* probably null Het
Zfp326 T A 5: 105,910,231 V412E probably damaging Het
Zfp831 A G 2: 174,645,868 R779G possibly damaging Het
Other mutations in Txlnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Txlnb APN 10 17842963 missense probably damaging 0.98
IGL01820:Txlnb APN 10 17806858 critical splice donor site probably null
IGL02244:Txlnb APN 10 17843368 missense probably benign 0.00
IGL02247:Txlnb APN 10 17830342 missense possibly damaging 0.55
IGL02247:Txlnb APN 10 17841528 splice site probably benign
IGL02931:Txlnb APN 10 17827982 missense probably damaging 1.00
IGL03006:Txlnb APN 10 17838975 missense probably damaging 0.96
IGL02991:Txlnb UTSW 10 17841453 missense probably damaging 1.00
R0092:Txlnb UTSW 10 17842755 missense possibly damaging 0.91
R0800:Txlnb UTSW 10 17799492 missense possibly damaging 0.50
R0908:Txlnb UTSW 10 17799177 missense probably damaging 1.00
R1172:Txlnb UTSW 10 17842756 missense probably benign 0.23
R1174:Txlnb UTSW 10 17842756 missense probably benign 0.23
R1340:Txlnb UTSW 10 17842740 missense probably damaging 1.00
R1373:Txlnb UTSW 10 17838947 missense probably damaging 1.00
R1641:Txlnb UTSW 10 17806773 missense possibly damaging 0.55
R1680:Txlnb UTSW 10 17843233 missense probably benign 0.01
R1710:Txlnb UTSW 10 17843455 missense possibly damaging 0.90
R1741:Txlnb UTSW 10 17838947 missense probably damaging 1.00
R1955:Txlnb UTSW 10 17799420 missense probably damaging 0.98
R2031:Txlnb UTSW 10 17830314 missense possibly damaging 0.85
R4300:Txlnb UTSW 10 17827925 missense probably damaging 1.00
R4483:Txlnb UTSW 10 17838997 nonsense probably null
R4484:Txlnb UTSW 10 17838997 nonsense probably null
R4656:Txlnb UTSW 10 17815276 missense probably damaging 1.00
R4664:Txlnb UTSW 10 17843194 missense probably damaging 0.99
R4723:Txlnb UTSW 10 17799267 missense probably benign 0.02
R4974:Txlnb UTSW 10 17838969 missense probably damaging 1.00
R5291:Txlnb UTSW 10 17799396 missense possibly damaging 0.92
R5538:Txlnb UTSW 10 17838909 missense probably damaging 1.00
R5791:Txlnb UTSW 10 17799128 missense probably benign 0.01
R5967:Txlnb UTSW 10 17799420 missense probably damaging 0.98
R6144:Txlnb UTSW 10 17843166 missense probably benign 0.17
R7146:Txlnb UTSW 10 17827798 missense possibly damaging 0.81
R7171:Txlnb UTSW 10 17842984 missense probably benign 0.22
R7253:Txlnb UTSW 10 17827885 missense probably damaging 1.00
R7468:Txlnb UTSW 10 17799334 missense probably damaging 0.96
X0025:Txlnb UTSW 10 17799422 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- ATGGAGATTAATCATCCTGATCAGC -3'
(R):5'- TGCTCTTTATTGCTGACAGGC -3'

Sequencing Primer
(F):5'- ATCCTGATCAGCTCTCAGTGGAG -3'
(R):5'- GCTGACAGGCTCTTTGGC -3'
Posted On2018-02-27