Incidental Mutation 'R6212:Nodal'
ID503517
Institutional Source Beutler Lab
Gene Symbol Nodal
Ensembl Gene ENSMUSG00000037171
Gene Namenodal
SynonymsTg.413d
MMRRC Submission 044345-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6212 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location61417972-61425338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61423521 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 246 (H246Y)
Ref Sequence ENSEMBL: ENSMUSP00000039653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020288] [ENSMUST00000049339]
Predicted Effect probably benign
Transcript: ENSMUST00000020288
SMART Domains Protein: ENSMUSP00000020288
Gene: ENSMUSG00000020091

DomainStartEndE-ValueType
Pfam:eIF_4EBP 1 120 4.2e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000049339
AA Change: H246Y

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000039653
Gene: ENSMUSG00000037171
AA Change: H246Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 235 244 N/A INTRINSIC
TGFB 254 354 2.6e-58 SMART
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate the mature protein, which regulates early embryonic development. Homozygous knockout mice for this gene exhibit early embryonic lethality, while expression of a hypomorphic allele results in defects in anteroposterior and left-right patterning. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mutants fail to form a primitive streak, show placental defects and die at gastrulation. Hypomorphic mutants are defective in anterior-posterior, anterior-midline, and left-right body patterning, resulting in multiple organ defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,573,282 I116N probably damaging Het
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Ap3b1 C A 13: 94,493,699 H821N unknown Het
Apex1 C T 14: 50,926,893 P264S probably benign Het
Arhgap27 T C 11: 103,360,872 Y10C probably damaging Het
Bag6 A G 17: 35,140,302 T208A probably benign Het
Brd4 G T 17: 32,202,449 P771Q probably damaging Het
Capn3 A G 2: 120,477,186 S69G probably benign Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Celsr1 T C 15: 85,916,687 H2519R probably benign Het
Chd8 T A 14: 52,201,698 N48I probably damaging Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Dnhd1 C T 7: 105,704,048 P2803S probably damaging Het
Dusp26 G A 8: 31,094,224 D120N probably damaging Het
Epha6 T C 16: 60,425,356 H160R possibly damaging Het
Erg C T 16: 95,379,163 V215I probably damaging Het
Fam71f1 T C 6: 29,319,374 L59P probably damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gabbr2 T C 4: 46,681,189 D124G probably damaging Het
Gapdh T C 6: 125,162,698 H203R probably damaging Het
Ggnbp2 T C 11: 84,836,677 M42V possibly damaging Het
Hk2 C A 6: 82,728,842 A827S probably benign Het
Hoxa5 T C 6: 52,202,714 E227G probably damaging Het
Itgax C A 7: 128,130,332 H31N possibly damaging Het
Itgax A G 7: 128,147,853 D942G probably benign Het
Kars A T 8: 112,000,197 probably null Het
Lama3 T C 18: 12,513,645 F1739L probably damaging Het
Map2k1 A T 9: 64,205,163 L155Q probably damaging Het
Mcf2l A T 8: 13,017,431 D1013V probably damaging Het
Mocs1 G A 17: 49,435,196 G118S probably damaging Het
Ncam2 T C 16: 81,432,762 S37P probably damaging Het
Nfxl1 A G 5: 72,516,210 probably null Het
Nwd1 G A 8: 72,695,322 V999M possibly damaging Het
Oaz3 T A 3: 94,435,068 T139S probably benign Het
Olfr1347 T C 7: 6,488,368 probably null Het
Olfr58 A G 9: 19,783,289 D52G probably damaging Het
P3h3 T A 6: 124,845,643 T522S probably benign Het
Pgap1 A G 1: 54,514,893 F457S probably damaging Het
Prkce T C 17: 86,559,301 Y530H probably damaging Het
Ptpn3 A T 4: 57,270,070 C31S probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Serpinb6e T A 13: 33,841,237 N24Y probably damaging Het
Slc4a8 T C 15: 100,811,571 V937A possibly damaging Het
Smgc T A 15: 91,850,627 probably benign Het
Srcap T A 7: 127,549,689 N2027K probably damaging Het
Stra6l T C 4: 45,884,664 Y565H probably benign Het
Tmem262 A G 19: 6,080,638 E62G possibly damaging Het
Tnrc6a T A 7: 123,143,742 probably null Het
Txlnb T C 10: 17,799,309 I70T probably damaging Het
Whrn A T 4: 63,494,686 L25* probably null Het
Zfp326 T A 5: 105,910,231 V412E probably damaging Het
Zfp831 A G 2: 174,645,868 R779G possibly damaging Het
Other mutations in Nodal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Nodal APN 10 61418397 missense probably benign 0.00
IGL02153:Nodal APN 10 61424545 missense probably damaging 1.00
R1540:Nodal UTSW 10 61422985 missense probably damaging 0.96
R1993:Nodal UTSW 10 61418334 missense probably benign 0.05
R2086:Nodal UTSW 10 61423298 missense possibly damaging 0.76
R2317:Nodal UTSW 10 61418433 missense possibly damaging 0.83
R3110:Nodal UTSW 10 61424497 missense possibly damaging 0.75
R3112:Nodal UTSW 10 61424497 missense possibly damaging 0.75
R3973:Nodal UTSW 10 61423054 missense probably benign
R5785:Nodal UTSW 10 61423677 missense probably damaging 1.00
R5967:Nodal UTSW 10 61423667 missense probably damaging 0.99
R6166:Nodal UTSW 10 61424558 missense probably damaging 1.00
R6238:Nodal UTSW 10 61423479 missense probably damaging 0.96
X0026:Nodal UTSW 10 61424560 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGAGCAGAAAAGTGTTGGC -3'
(R):5'- AGCCAAGCATCATACCTGG -3'

Sequencing Primer
(F):5'- CAGAAAAGTGTTGGCATCAGC -3'
(R):5'- CATCATACCTGGATGTAGGCATG -3'
Posted On2018-02-27