Incidental Mutation 'R6212:Ggnbp2'
ID503518
Institutional Source Beutler Lab
Gene Symbol Ggnbp2
Ensembl Gene ENSMUSG00000020530
Gene Namegametogenetin binding protein 2
SynonymsZfp403, DIF-3, D330017P12Rik
MMRRC Submission 044345-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock #R6212 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location84832361-84870817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84836677 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 42 (M42V)
Ref Sequence ENSEMBL: ENSMUSP00000128109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018547] [ENSMUST00000100686] [ENSMUST00000108081] [ENSMUST00000154915] [ENSMUST00000168434] [ENSMUST00000170741] [ENSMUST00000172405]
Predicted Effect probably benign
Transcript: ENSMUST00000018547
AA Change: M513V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000018547
Gene: ENSMUSG00000020530
AA Change: M513V

DomainStartEndE-ValueType
low complexity region 179 185 N/A INTRINSIC
coiled coil region 393 426 N/A INTRINSIC
low complexity region 570 584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100686
AA Change: M451V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000098252
Gene: ENSMUSG00000020530
AA Change: M451V

DomainStartEndE-ValueType
coiled coil region 351 388 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108081
AA Change: M473V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000103716
Gene: ENSMUSG00000020530
AA Change: M473V

DomainStartEndE-ValueType
coiled coil region 353 386 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132098
SMART Domains Protein: ENSMUSP00000129898
Gene: ENSMUSG00000020530

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154915
AA Change: M471V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000117482
Gene: ENSMUSG00000020530
AA Change: M471V

DomainStartEndE-ValueType
coiled coil region 351 384 N/A INTRINSIC
low complexity region 528 542 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168267
Predicted Effect probably benign
Transcript: ENSMUST00000168434
AA Change: M471V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000130013
Gene: ENSMUSG00000020530
AA Change: M471V

DomainStartEndE-ValueType
coiled coil region 351 384 N/A INTRINSIC
low complexity region 528 542 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170741
AA Change: M42V

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128109
Gene: ENSMUSG00000020530
AA Change: M42V

DomainStartEndE-ValueType
low complexity region 99 113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172405
AA Change: M473V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000127584
Gene: ENSMUSG00000020530
AA Change: M473V

DomainStartEndE-ValueType
coiled coil region 353 386 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 96% (52/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit lethality throughout fetal growth and development associated with pallor and alterations in placental labyrinth vasculature morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,573,282 I116N probably damaging Het
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Ap3b1 C A 13: 94,493,699 H821N unknown Het
Apex1 C T 14: 50,926,893 P264S probably benign Het
Arhgap27 T C 11: 103,360,872 Y10C probably damaging Het
Bag6 A G 17: 35,140,302 T208A probably benign Het
Brd4 G T 17: 32,202,449 P771Q probably damaging Het
Capn3 A G 2: 120,477,186 S69G probably benign Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Celsr1 T C 15: 85,916,687 H2519R probably benign Het
Chd8 T A 14: 52,201,698 N48I probably damaging Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Dnhd1 C T 7: 105,704,048 P2803S probably damaging Het
Dusp26 G A 8: 31,094,224 D120N probably damaging Het
Epha6 T C 16: 60,425,356 H160R possibly damaging Het
Erg C T 16: 95,379,163 V215I probably damaging Het
Fam71f1 T C 6: 29,319,374 L59P probably damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gabbr2 T C 4: 46,681,189 D124G probably damaging Het
Gapdh T C 6: 125,162,698 H203R probably damaging Het
Hk2 C A 6: 82,728,842 A827S probably benign Het
Hoxa5 T C 6: 52,202,714 E227G probably damaging Het
Itgax C A 7: 128,130,332 H31N possibly damaging Het
Itgax A G 7: 128,147,853 D942G probably benign Het
Kars A T 8: 112,000,197 probably null Het
Lama3 T C 18: 12,513,645 F1739L probably damaging Het
Map2k1 A T 9: 64,205,163 L155Q probably damaging Het
Mcf2l A T 8: 13,017,431 D1013V probably damaging Het
Mocs1 G A 17: 49,435,196 G118S probably damaging Het
Ncam2 T C 16: 81,432,762 S37P probably damaging Het
Nfxl1 A G 5: 72,516,210 probably null Het
Nodal C T 10: 61,423,521 H246Y possibly damaging Het
Nwd1 G A 8: 72,695,322 V999M possibly damaging Het
Oaz3 T A 3: 94,435,068 T139S probably benign Het
Olfr1347 T C 7: 6,488,368 probably null Het
Olfr58 A G 9: 19,783,289 D52G probably damaging Het
P3h3 T A 6: 124,845,643 T522S probably benign Het
Pgap1 A G 1: 54,514,893 F457S probably damaging Het
Prkce T C 17: 86,559,301 Y530H probably damaging Het
Ptpn3 A T 4: 57,270,070 C31S probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Serpinb6e T A 13: 33,841,237 N24Y probably damaging Het
Slc4a8 T C 15: 100,811,571 V937A possibly damaging Het
Smgc T A 15: 91,850,627 probably benign Het
Srcap T A 7: 127,549,689 N2027K probably damaging Het
Stra6l T C 4: 45,884,664 Y565H probably benign Het
Tmem262 A G 19: 6,080,638 E62G possibly damaging Het
Tnrc6a T A 7: 123,143,742 probably null Het
Txlnb T C 10: 17,799,309 I70T probably damaging Het
Whrn A T 4: 63,494,686 L25* probably null Het
Zfp326 T A 5: 105,910,231 V412E probably damaging Het
Zfp831 A G 2: 174,645,868 R779G possibly damaging Het
Other mutations in Ggnbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Ggnbp2 APN 11 84840404 missense possibly damaging 0.49
IGL02095:Ggnbp2 APN 11 84833128 missense probably damaging 1.00
IGL02366:Ggnbp2 APN 11 84841601 missense probably damaging 1.00
IGL02548:Ggnbp2 APN 11 84862286 missense possibly damaging 0.78
R0211:Ggnbp2 UTSW 11 84840313 missense probably damaging 1.00
R0211:Ggnbp2 UTSW 11 84840313 missense probably damaging 1.00
R0375:Ggnbp2 UTSW 11 84836374 nonsense probably null
R0415:Ggnbp2 UTSW 11 84833225 splice site probably benign
R0433:Ggnbp2 UTSW 11 84836420 missense probably damaging 1.00
R0589:Ggnbp2 UTSW 11 84836451 missense probably damaging 1.00
R0970:Ggnbp2 UTSW 11 84862312 missense possibly damaging 0.83
R1413:Ggnbp2 UTSW 11 84833129 missense probably damaging 1.00
R1912:Ggnbp2 UTSW 11 84862296 missense probably benign 0.02
R1997:Ggnbp2 UTSW 11 84860561 missense probably damaging 1.00
R2161:Ggnbp2 UTSW 11 84834433 missense probably benign 0.08
R2220:Ggnbp2 UTSW 11 84836613 missense possibly damaging 0.46
R2879:Ggnbp2 UTSW 11 84832971 unclassified probably null
R2941:Ggnbp2 UTSW 11 84841581 missense probably damaging 1.00
R3726:Ggnbp2 UTSW 11 84854094 missense possibly damaging 0.93
R4662:Ggnbp2 UTSW 11 84862246 missense probably damaging 1.00
R4771:Ggnbp2 UTSW 11 84834488 missense probably benign 0.00
R5212:Ggnbp2 UTSW 11 84854021 intron probably benign
R5310:Ggnbp2 UTSW 11 84869968 start codon destroyed probably null 1.00
R5479:Ggnbp2 UTSW 11 84854343 missense probably benign
R5924:Ggnbp2 UTSW 11 84858537 missense possibly damaging 0.61
R6700:Ggnbp2 UTSW 11 84840105 missense probably damaging 1.00
R6931:Ggnbp2 UTSW 11 84833167 missense probably damaging 1.00
R7031:Ggnbp2 UTSW 11 84860641 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGAACACAGGAATCTTCA -3'
(R):5'- CACAAAACATGTAAATGGTAATCGTAC -3'

Sequencing Primer
(F):5'- CCCAAGCATACCATGTTCA -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2018-02-27