Incidental Mutation 'R6212:Erg'
ID503530
Institutional Source Beutler Lab
Gene Symbol Erg
Ensembl Gene ENSMUSG00000040732
Gene NameETS transcription factor
SynonymsD030036I24Rik
MMRRC Submission 044345-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6212 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location95360204-95530365 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 95379163 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 215 (V215I)
Ref Sequence ENSEMBL: ENSMUSP00000132766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077773] [ENSMUST00000113846] [ENSMUST00000113848] [ENSMUST00000118113] [ENSMUST00000121809] [ENSMUST00000122199] [ENSMUST00000171646] [ENSMUST00000176345] [ENSMUST00000177450]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077773
AA Change: V215I

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000076949
Gene: ENSMUSG00000040732
AA Change: V215I

DomainStartEndE-ValueType
SAM_PNT 122 206 6.99e-32 SMART
ETS 293 378 9.9e-58 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113846
AA Change: V215I

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109477
Gene: ENSMUSG00000040732
AA Change: V215I

DomainStartEndE-ValueType
SAM_PNT 122 206 6.99e-32 SMART
ETS 317 402 9.9e-58 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113848
AA Change: V215I

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109479
Gene: ENSMUSG00000040732
AA Change: V215I

DomainStartEndE-ValueType
SAM_PNT 122 206 6.99e-32 SMART
ETS 294 379 9.9e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118113
AA Change: V208I

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000112698
Gene: ENSMUSG00000040732
AA Change: V208I

DomainStartEndE-ValueType
SAM_PNT 115 199 6.99e-32 SMART
ETS 287 372 9.9e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121809
AA Change: V215I

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113723
Gene: ENSMUSG00000040732
AA Change: V215I

DomainStartEndE-ValueType
SAM_PNT 115 199 6.99e-32 SMART
ETS 286 371 9.9e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122199
AA Change: V208I

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000114072
Gene: ENSMUSG00000040732
AA Change: V208I

DomainStartEndE-ValueType
SAM_PNT 115 199 6.99e-32 SMART
ETS 310 395 9.9e-58 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171646
AA Change: V215I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132766
Gene: ENSMUSG00000040732
AA Change: V215I

DomainStartEndE-ValueType
SAM_PNT 122 206 6.99e-32 SMART
ETS 270 355 9.9e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176345
AA Change: V208I

PolyPhen 2 Score 0.295 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135568
Gene: ENSMUSG00000040732
AA Change: V208I

DomainStartEndE-ValueType
SAM_PNT 23 107 6.99e-32 SMART
ETS 218 303 9.9e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177450
AA Change: V116I

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000134930
Gene: ENSMUSG00000040732
AA Change: V116I

DomainStartEndE-ValueType
SAM_PNT 23 107 6.99e-32 SMART
ETS 194 279 9.9e-58 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the erythroblast transformation-specific (ETS) family of transcriptions factors. All members of this family are key regulators of embryonic development, cell proliferation, differentiation, angiogenesis, inflammation, and apoptosis. The protein encoded by this gene is mainly expressed in the nucleus. It contains an ETS DNA-binding domain and a PNT (pointed) domain which is implicated in the self-association of chimeric oncoproteins. This protein is required for platelet adhesion to the subendothelium, inducing vascular cell remodeling. It also regulates hematopoesis, and the differentiation and maturation of megakaryocytic cells. This gene is involved in chromosomal translocations, resulting in different fusion gene products, such as TMPSSR2-ERG and NDRG1-ERG in prostate cancer, EWS-ERG in Ewing's sarcoma and FUS-ERG in acute myeloid leukemia. More than two dozens of transcript variants generated from combinatorial usage of three alternative promoters and multiple alternative splicing events have been reported, but the full-length nature of many of these variants has not been determined. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for an ENU-induced mutation or a knock-out of isoforms 5 - 7 die during organogenesis and exhibit embryonic growth retardation. Mice homozygous for a knock-out of isoforms 1 - 4 are viable and fertile with no overt abnnormalities. Homozygous knock-out mice develop pulmonary venoocclusive disease, with pancytopenia, pulmonary hemorrhage and hypertension, and heart right ventricle hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,573,282 I116N probably damaging Het
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Ap3b1 C A 13: 94,493,699 H821N unknown Het
Apex1 C T 14: 50,926,893 P264S probably benign Het
Arhgap27 T C 11: 103,360,872 Y10C probably damaging Het
Bag6 A G 17: 35,140,302 T208A probably benign Het
Brd4 G T 17: 32,202,449 P771Q probably damaging Het
Capn3 A G 2: 120,477,186 S69G probably benign Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Celsr1 T C 15: 85,916,687 H2519R probably benign Het
Chd8 T A 14: 52,201,698 N48I probably damaging Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Dnhd1 C T 7: 105,704,048 P2803S probably damaging Het
Dusp26 G A 8: 31,094,224 D120N probably damaging Het
Epha6 T C 16: 60,425,356 H160R possibly damaging Het
Fam71f1 T C 6: 29,319,374 L59P probably damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gabbr2 T C 4: 46,681,189 D124G probably damaging Het
Gapdh T C 6: 125,162,698 H203R probably damaging Het
Ggnbp2 T C 11: 84,836,677 M42V possibly damaging Het
Hk2 C A 6: 82,728,842 A827S probably benign Het
Hoxa5 T C 6: 52,202,714 E227G probably damaging Het
Itgax C A 7: 128,130,332 H31N possibly damaging Het
Itgax A G 7: 128,147,853 D942G probably benign Het
Kars A T 8: 112,000,197 probably null Het
Lama3 T C 18: 12,513,645 F1739L probably damaging Het
Map2k1 A T 9: 64,205,163 L155Q probably damaging Het
Mcf2l A T 8: 13,017,431 D1013V probably damaging Het
Mocs1 G A 17: 49,435,196 G118S probably damaging Het
Ncam2 T C 16: 81,432,762 S37P probably damaging Het
Nfxl1 A G 5: 72,516,210 probably null Het
Nodal C T 10: 61,423,521 H246Y possibly damaging Het
Nwd1 G A 8: 72,695,322 V999M possibly damaging Het
Oaz3 T A 3: 94,435,068 T139S probably benign Het
Olfr1347 T C 7: 6,488,368 probably null Het
Olfr58 A G 9: 19,783,289 D52G probably damaging Het
P3h3 T A 6: 124,845,643 T522S probably benign Het
Pgap1 A G 1: 54,514,893 F457S probably damaging Het
Prkce T C 17: 86,559,301 Y530H probably damaging Het
Ptpn3 A T 4: 57,270,070 C31S probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Serpinb6e T A 13: 33,841,237 N24Y probably damaging Het
Slc4a8 T C 15: 100,811,571 V937A possibly damaging Het
Smgc T A 15: 91,850,627 probably benign Het
Srcap T A 7: 127,549,689 N2027K probably damaging Het
Stra6l T C 4: 45,884,664 Y565H probably benign Het
Tmem262 A G 19: 6,080,638 E62G possibly damaging Het
Tnrc6a T A 7: 123,143,742 probably null Het
Txlnb T C 10: 17,799,309 I70T probably damaging Het
Whrn A T 4: 63,494,686 L25* probably null Het
Zfp326 T A 5: 105,910,231 V412E probably damaging Het
Zfp831 A G 2: 174,645,868 R779G possibly damaging Het
Other mutations in Erg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Erg APN 16 95369989 splice site probably benign
IGL01096:Erg APN 16 95390053 splice site probably benign
IGL01446:Erg APN 16 95361282 missense probably damaging 1.00
IGL01459:Erg APN 16 95361282 missense probably damaging 1.00
IGL01984:Erg APN 16 95409927 missense probably damaging 1.00
IGL03164:Erg APN 16 95409871 missense possibly damaging 0.94
PIT4515001:Erg UTSW 16 95409760 missense probably benign 0.09
R0499:Erg UTSW 16 95360983 nonsense probably null
R0734:Erg UTSW 16 95370025 missense possibly damaging 0.61
R1880:Erg UTSW 16 95377309 missense probably benign 0.07
R2069:Erg UTSW 16 95361078 missense probably damaging 1.00
R4710:Erg UTSW 16 95390034 missense possibly damaging 0.92
R4749:Erg UTSW 16 95361170 missense probably damaging 1.00
R5053:Erg UTSW 16 95524534 missense probably benign 0.00
R5284:Erg UTSW 16 95459243 start codon destroyed probably null 0.01
R5694:Erg UTSW 16 95361031 missense probably benign 0.00
R6258:Erg UTSW 16 95380241 missense probably damaging 0.99
R6260:Erg UTSW 16 95380241 missense probably damaging 0.99
R6856:Erg UTSW 16 95368651 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AATGGCTTCGCTCCCACATC -3'
(R):5'- TTTAGATGGTTCTAGCAGCCTCC -3'

Sequencing Primer
(F):5'- CTGTGTTCTAACCCCTAACCTGTGAG -3'
(R):5'- GTCCTGGAACTCACTCAGTAG -3'
Posted On2018-02-27