Mutagenetix > Incidental Mutation

Incidental Mutation 'R6214:Dmtn'

503632

Institutional Source

Beutler Lab

Gene Symbol

Dmtn

Ensembl Gene

ENSMUSG00000022099

Gene Name

dematin actin binding protein

Synonyms

dematin, Epb4.9

MMRRC Submission

044347-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.160) question?

Stock #

R6214 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70839624-70873488 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70850776 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 205 (I205T)

Ref Sequence

ENSEMBL: ENSMUSP00000154373 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022694] [ENSMUST00000022695] [ENSMUST00000110984] [ENSMUST00000226543] [ENSMUST00000227331] [ENSMUST00000228001] [ENSMUST00000228824] [ENSMUST00000228009] [ENSMUST00000228295]

AlphaFold

Q9WV69

Predicted Effect

probably benign
Transcript: ENSMUST00000022694
AA Change: I230T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000022694
Gene: ENSMUSG00000022099
AA Change: I230T

Domain	Start	End	E-Value	Type
Pfam:AbLIM_anchor	8	93	8e-30	PFAM
Pfam:AbLIM_anchor	79	347	1.9e-58	PFAM
VHP	348	383	1.88e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000022695
AA Change: I205T

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000022695
Gene: ENSMUSG00000022099
AA Change: I205T

Domain	Start	End	E-Value	Type
low complexity region	60	72	N/A	INTRINSIC
low complexity region	88	99	N/A	INTRINSIC
low complexity region	149	160	N/A	INTRINSIC
coiled coil region	188	220	N/A	INTRINSIC
low complexity region	252	267	N/A	INTRINSIC
VHP	345	380	1.88e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110984
AA Change: I230T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000106612
Gene: ENSMUSG00000022099
AA Change: I230T

Domain	Start	End	E-Value	Type
low complexity region	11	29	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
low complexity region	113	124	N/A	INTRINSIC
low complexity region	174	185	N/A	INTRINSIC
coiled coil region	213	245	N/A	INTRINSIC
low complexity region	277	292	N/A	INTRINSIC
VHP	348	383	1.88e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226543

Predicted Effect

probably benign
Transcript: ENSMUST00000227331

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227453

Predicted Effect

probably benign
Transcript: ENSMUST00000228001
AA Change: I205T

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

Predicted Effect

probably benign
Transcript: ENSMUST00000228824
AA Change: I205T

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

Predicted Effect

probably benign
Transcript: ENSMUST00000228009
AA Change: I230T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

Predicted Effect

probably benign
Transcript: ENSMUST00000228295
AA Change: I205T

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.8%

Validation Efficiency

97% (37/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an actin binding and bundling protein that plays a structural role in erythrocytes, by stabilizing and attaching the spectrin/actin cytoskeleton to the erythrocyte membrane in a phosphorylation-dependent manner. This protein contains a core domain in the N-terminus, and a headpiece domain in the C-terminus that binds F-actin. When purified from erythrocytes, this protein exists as a trimer composed of two 48 kDa polypeptides and a 52 kDa polypeptide. The different subunits arise from alternative splicing in the 3' coding region, where the headpiece domain is located. Disruption of this gene has been correlated with the autosomal dominant Marie Unna hereditary hypotrichosis disease, while loss of heterozygosity of this gene is thought to play a role in prostate cancer progression. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a targeted mutation display mild anemia and spherocytosis. Mutant erythrocytes are osmotically fragile and show reduced deformability and filterability as well as increased membrane fragmentation and selective loss of spectrin and actin from RBC membrane skeletons and vesicles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asap3	A	C	4: 135,968,736 (GRCm39)	D727A	possibly damaging	Het
Aste1	A	G	9: 105,274,056 (GRCm39)	K38E	probably damaging	Het
Atp13a5	T	C	16: 29,070,159 (GRCm39)	Y909C	probably damaging	Het
Ccdc13	A	G	9: 121,627,975 (GRCm39)		probably benign	Het
Cd79b	C	A	11: 106,203,267 (GRCm39)		probably null	Het
Chia1	T	C	3: 106,029,761 (GRCm39)	F132L	probably damaging	Het
Cntrl	A	G	2: 35,019,646 (GRCm39)	E491G	probably benign	Het
Ctdnep1	T	C	11: 69,880,334 (GRCm39)	F206L	probably damaging	Het
Dido1	T	C	2: 180,303,945 (GRCm39)	K1320E	probably damaging	Het
Dmbt1	G	T	7: 130,668,463 (GRCm39)	C573F	possibly damaging	Het
Eif4g3	C	T	4: 137,785,314 (GRCm39)	H137Y	probably damaging	Het
Flg2	G	T	3: 93,109,166 (GRCm39)	C398F	possibly damaging	Het
Gabbr1	A	G	17: 37,380,257 (GRCm39)	D604G	probably damaging	Het
Glis2	T	A	16: 4,428,197 (GRCm39)	L83*	probably null	Het
Glra3	A	G	8: 56,444,291 (GRCm39)		probably null	Het
Hipk3	T	C	2: 104,264,086 (GRCm39)	D804G	probably damaging	Het
Kcnd1	G	C	X: 7,690,148 (GRCm39)	A23P	probably damaging	Homo
Lrrc9	A	T	12: 72,506,627 (GRCm39)	E301D	probably damaging	Het
Ms4a6c	T	C	19: 11,448,500 (GRCm39)	I11T	possibly damaging	Het
Myo1d	A	T	11: 80,670,617 (GRCm39)	M1K	probably null	Het
Nav3	A	G	10: 109,688,426 (GRCm39)	L617P	probably damaging	Het
Or8b3b	A	G	9: 38,584,510 (GRCm39)	S90P	probably benign	Het
Pcsk7	A	C	9: 45,821,674 (GRCm39)	N156T	possibly damaging	Het
Pde4d	C	T	13: 110,085,967 (GRCm39)	S515L	probably damaging	Het
Pira13	A	G	7: 3,824,717 (GRCm39)	I554T	probably damaging	Het
Prom2	A	G	2: 127,381,695 (GRCm39)		probably null	Het
Rsf1	G	GACGGCGGCA	7: 97,229,116 (GRCm39)		probably benign	Het
Scn3a	T	C	2: 65,325,380 (GRCm39)	I1046V	probably benign	Het
Slc13a1	A	T	6: 24,090,795 (GRCm39)	Y541*	probably null	Het
Speer1d	C	T	5: 11,307,197 (GRCm39)	T25I	probably damaging	Het
Spen	C	T	4: 141,206,423 (GRCm39)	E735K	unknown	Het
Tm6sf2	T	C	8: 70,525,724 (GRCm39)	V27A	possibly damaging	Het
Trim21	A	G	7: 102,208,646 (GRCm39)	S358P	probably damaging	Het
Ttc21a	A	G	9: 119,795,838 (GRCm39)	Y1224C	probably damaging	Het
Ttn	T	A	2: 76,710,552 (GRCm39)		probably benign	Het
Vmn2r99	A	G	17: 19,602,820 (GRCm39)	Q525R	probably benign	Het
Vsig10	G	A	5: 117,481,989 (GRCm39)	C393Y	probably damaging	Het
Ywhag	A	G	5: 135,939,928 (GRCm39)	I222T	probably damaging	Het

Other mutations in Dmtn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01802:Dmtn	APN	14	70,842,259 (GRCm39)	missense	probably damaging	1.00
IGL02836:Dmtn	APN	14	70,853,518 (GRCm39)	missense	probably damaging	1.00
R1248:Dmtn	UTSW	14	70,850,098 (GRCm39)	splice site	probably benign
R2428:Dmtn	UTSW	14	70,850,843 (GRCm39)	missense	probably damaging	1.00
R3438:Dmtn	UTSW	14	70,850,156 (GRCm39)	missense	probably damaging	0.98
R4851:Dmtn	UTSW	14	70,842,254 (GRCm39)	missense	probably damaging	1.00
R4917:Dmtn	UTSW	14	70,843,159 (GRCm39)	missense	probably damaging	0.98
R4924:Dmtn	UTSW	14	70,855,399 (GRCm39)	missense	probably benign	0.25
R5633:Dmtn	UTSW	14	70,842,419 (GRCm39)	missense	probably benign	0.18
R6170:Dmtn	UTSW	14	70,854,795 (GRCm39)	missense	probably damaging	1.00
R6215:Dmtn	UTSW	14	70,850,776 (GRCm39)	missense	probably benign	0.05
R6639:Dmtn	UTSW	14	70,854,870 (GRCm39)	missense	probably damaging	1.00
R6860:Dmtn	UTSW	14	70,852,322 (GRCm39)	missense	possibly damaging	0.94
R7139:Dmtn	UTSW	14	70,854,867 (GRCm39)	missense	probably benign	0.12
R7242:Dmtn	UTSW	14	70,855,460 (GRCm39)	missense	probably damaging	1.00
R7380:Dmtn	UTSW	14	70,854,768 (GRCm39)	missense	probably damaging	0.99
R7572:Dmtn	UTSW	14	70,842,777 (GRCm39)	missense	possibly damaging	0.93
R8806:Dmtn	UTSW	14	70,852,388 (GRCm39)	missense	probably benign	0.26
R8888:Dmtn	UTSW	14	70,850,144 (GRCm39)	missense	probably benign	0.18
R8895:Dmtn	UTSW	14	70,850,144 (GRCm39)	missense	probably benign	0.18
R9027:Dmtn	UTSW	14	70,853,555 (GRCm39)	missense	probably damaging	0.99
R9032:Dmtn	UTSW	14	70,853,534 (GRCm39)	missense	probably damaging	0.99
R9085:Dmtn	UTSW	14	70,853,534 (GRCm39)	missense	probably damaging	0.99
R9694:Dmtn	UTSW	14	70,852,732 (GRCm39)	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TTAATGTCCAGGACCACTGTTCC -3'
(R):5'- AGACAGACTTTGTTCCAGCC -3'

Sequencing Primer
(F):5'- TCCTGGTAAAGAAGAGGCACCTC -3'
(R):5'- AGCCCTGTTCCACAAGCTG -3'

Posted On

2018-02-27