Incidental Mutation 'R6216:Nf1'
ID503732
Institutional Source Beutler Lab
Gene Symbol Nf1
Ensembl Gene ENSMUSG00000020716
Gene Nameneurofibromin 1
SynonymsNf-1, neurofibromin
MMRRC Submission
Accession Numbers

Genbank: NM_010897; MGI: 97306

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6216 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location79339693-79581612 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79411607 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 334 (I334V)
Ref Sequence ENSEMBL: ENSMUSP00000103886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000108251] [ENSMUST00000219057]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071325
AA Change: I334V

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716
AA Change: I334V

DomainStartEndE-ValueType
RasGAP 1189 1559 2.56e-151 SMART
SEC14 1585 1737 2.36e-11 SMART
low complexity region 2619 2629 N/A INTRINSIC
low complexity region 2750 2763 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108251
AA Change: I334V

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103886
Gene: ENSMUSG00000020716
AA Change: I334V

DomainStartEndE-ValueType
RasGAP 1189 1538 1.23e-153 SMART
SEC14 1564 1716 2.36e-11 SMART
low complexity region 2598 2608 N/A INTRINSIC
low complexity region 2729 2742 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131800
Predicted Effect possibly damaging
Transcript: ENSMUST00000219057
AA Change: I334V

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos die by day 14.5 with enlarged head and chest, pale liver, microphthalmia, cardiac defects and delayed organ development. Heterozygotes have elevated astrocyte number, predisposition to multiple tumor types and learning/memory deficits. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(16)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,257,627 D488G probably benign Het
Adgrv1 C A 13: 81,524,471 probably null Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alkbh3 G A 2: 94,008,536 probably benign Het
Ankrd22 A T 19: 34,124,169 probably null Het
Anks1b A G 10: 90,260,756 D425G probably damaging Het
Arid2 A G 15: 96,356,909 D212G probably benign Het
Bbx A T 16: 50,251,388 S225T probably benign Het
Bivm T A 1: 44,126,868 probably null Het
Bpifb3 A G 2: 153,925,853 Y282C probably benign Het
Cacna1h A T 17: 25,378,819 I1767N probably damaging Het
Ccdc28a G T 10: 18,224,971 S36* probably null Het
Ccser2 A G 14: 36,940,508 S240P probably damaging Het
Ceacam1 A T 7: 25,471,996 S348T probably benign Het
Ddx49 C T 8: 70,297,284 G161D probably damaging Het
Dhx16 A G 17: 35,882,972 E353G possibly damaging Het
Etv2 A G 7: 30,634,611 probably null Het
Extl1 T C 4: 134,363,130 T345A probably benign Het
Fam163a A T 1: 156,078,995 S137T probably benign Het
Fermt2 A T 14: 45,459,881 M671K possibly damaging Het
Fsd1l T C 4: 53,694,742 C388R probably damaging Het
Galnt18 A C 7: 111,513,550 V470G probably benign Het
Grin2b T A 6: 135,772,399 I602F probably damaging Het
Gucy1b1 G T 3: 82,046,713 probably null Het
Hace1 T C 10: 45,618,547 V151A probably benign Het
Hadhb T A 5: 30,174,931 D258E probably benign Het
Heatr1 C T 13: 12,432,664 T1746I probably benign Het
Hrnr T C 3: 93,332,162 S3236P unknown Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Kiz C A 2: 146,889,497 D302E probably damaging Het
Kng2 A T 16: 22,987,593 W619R probably damaging Het
Mfap3l C A 8: 60,671,807 T361K probably damaging Het
Mlec T C 5: 115,150,317 H160R probably benign Het
Myo16 T C 8: 10,315,494 L89P probably benign Het
Neb T C 2: 52,224,552 I4232V probably benign Het
Nipbl A C 15: 8,318,383 F1942V probably damaging Het
Olfr1205 T C 2: 88,831,311 S65P probably damaging Het
Olfr1242 C A 2: 89,493,722 V197F probably damaging Het
Olfr642 A G 7: 104,049,695 Y220H probably damaging Het
Olfr699 A T 7: 106,790,458 I181N probably benign Het
Pabpc2 G T 18: 39,774,719 A346S probably damaging Het
Paxip1 T C 5: 27,766,173 T393A unknown Het
Pcdhgb5 A T 18: 37,731,928 T259S probably benign Het
Pfkp A T 13: 6,619,188 L253H probably benign Het
Piezo1 T C 8: 122,489,130 D1428G probably benign Het
Pih1d3 A T 1: 31,223,351 D138V probably damaging Het
Pkd1l2 T G 8: 117,081,470 D105A probably damaging Het
Pou2f1 G T 1: 165,880,320 probably benign Het
Ppfia4 T C 1: 134,329,183 E100G probably damaging Het
Ppp1r15a G T 7: 45,524,022 T454K probably damaging Het
Prpsap1 A T 11: 116,471,413 I381N probably damaging Het
Ptx3 T A 3: 66,224,844 V262E probably damaging Het
Rab21 A T 10: 115,294,926 H158Q probably benign Het
Rasa2 A G 9: 96,544,304 S830P probably damaging Het
Rdh1 G A 10: 127,764,753 S215N probably benign Het
Rhot1 G A 11: 80,251,059 R463H probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Selenom A T 11: 3,514,915 probably benign Het
Selenop T C 15: 3,279,465 C300R probably damaging Het
Skint1 T A 4: 112,021,482 S204T probably benign Het
Ss18l1 A G 2: 180,061,913 N313S unknown Het
Sycp2l A G 13: 41,141,724 D289G probably damaging Het
Terf1 C T 1: 15,818,997 H188Y probably benign Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Trdn A G 10: 33,305,069 T357A probably damaging Het
Trip11 A C 12: 101,890,600 M401R probably benign Het
Ubald2 A C 11: 116,434,385 D26A probably benign Het
Ube2w C G 1: 16,619,284 probably benign Het
Vmn2r101 T A 17: 19,591,005 S450R probably benign Het
Other mutations in Nf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Nf1 APN 11 79395905 missense probably damaging 0.99
IGL00801:Nf1 APN 11 79428700 splice site probably benign
IGL00823:Nf1 APN 11 79565517 missense probably damaging 1.00
IGL00945:Nf1 APN 11 79469803 missense probably damaging 0.99
IGL00960:Nf1 APN 11 79445121 missense probably damaging 1.00
IGL01118:Nf1 APN 11 79546986 missense probably damaging 0.99
IGL01604:Nf1 APN 11 79441709 splice site probably benign
IGL01637:Nf1 APN 11 79547120 missense probably damaging 1.00
IGL01659:Nf1 APN 11 79559449 missense probably benign
IGL01764:Nf1 APN 11 79384187 missense probably benign
IGL01772:Nf1 APN 11 79390249 missense probably damaging 1.00
IGL02047:Nf1 APN 11 79425535 missense probably benign 0.04
IGL02052:Nf1 APN 11 79412727 missense probably damaging 1.00
IGL02071:Nf1 APN 11 79444121 missense possibly damaging 0.96
IGL02312:Nf1 APN 11 79444648 missense possibly damaging 0.95
IGL02341:Nf1 APN 11 79564926 missense probably benign 0.33
IGL02390:Nf1 APN 11 79565935 missense possibly damaging 0.64
IGL02390:Nf1 APN 11 79411676 splice site probably benign
IGL02475:Nf1 APN 11 79535667 missense probably damaging 1.00
IGL02567:Nf1 APN 11 79547143 missense probably damaging 1.00
IGL02571:Nf1 APN 11 79428627 missense probably damaging 1.00
IGL02664:Nf1 APN 11 79444598 critical splice acceptor site probably null
IGL02664:Nf1 APN 11 79444599 critical splice acceptor site probably null
IGL02992:Nf1 APN 11 79434933 splice site probably benign
IGL03006:Nf1 APN 11 79545431 missense probably damaging 1.00
IGL03216:Nf1 APN 11 79564895 missense probably benign 0.17
Franklin UTSW 11 79473320 splice site probably null
Jefferson UTSW 11 79446864 missense probably damaging 1.00
Phyletic_dwarf UTSW 11 79454189 missense probably damaging 1.00
C9142:Nf1 UTSW 11 79556731 missense probably damaging 0.98
I2289:Nf1 UTSW 11 79547776 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0081:Nf1 UTSW 11 79453979 splice site probably benign
R0115:Nf1 UTSW 11 79468876 critical splice donor site probably null
R0144:Nf1 UTSW 11 79547127 missense probably damaging 1.00
R0196:Nf1 UTSW 11 79468769 missense possibly damaging 0.94
R0196:Nf1 UTSW 11 79578272 missense probably damaging 1.00
R0217:Nf1 UTSW 11 79428574 splice site probably benign
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0255:Nf1 UTSW 11 79408699 splice site probably null
R0362:Nf1 UTSW 11 79536878 missense probably damaging 1.00
R0364:Nf1 UTSW 11 79441957 nonsense probably null
R0464:Nf1 UTSW 11 79556789 missense probably benign 0.17
R0511:Nf1 UTSW 11 79438769 missense probably benign 0.01
R0549:Nf1 UTSW 11 79468771 missense probably damaging 0.99
R0585:Nf1 UTSW 11 79568701 missense probably damaging 0.99
R0636:Nf1 UTSW 11 79535703 missense probably damaging 0.99
R0924:Nf1 UTSW 11 79453866 missense probably damaging 0.98
R0942:Nf1 UTSW 11 79438711 missense probably benign 0.00
R1022:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1024:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1350:Nf1 UTSW 11 79412687 missense probably damaging 1.00
R1365:Nf1 UTSW 11 79547885 splice site probably null
R1395:Nf1 UTSW 11 79535983 missense possibly damaging 0.49
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1477:Nf1 UTSW 11 79395859 nonsense probably null
R1508:Nf1 UTSW 11 79440909 missense probably damaging 1.00
R1512:Nf1 UTSW 11 79390369 missense probably damaging 1.00
R1605:Nf1 UTSW 11 79440923 missense probably benign 0.01
R1680:Nf1 UTSW 11 79550998 nonsense probably null
R1704:Nf1 UTSW 11 79463301 splice site probably null
R1707:Nf1 UTSW 11 79535604 missense probably damaging 1.00
R1741:Nf1 UTSW 11 79443931 missense probably benign
R1761:Nf1 UTSW 11 79384265 missense probably damaging 1.00
R1800:Nf1 UTSW 11 79553968 missense possibly damaging 0.94
R1873:Nf1 UTSW 11 79547161 missense probably damaging 1.00
R1966:Nf1 UTSW 11 79411564 missense possibly damaging 0.72
R1967:Nf1 UTSW 11 79412745 missense probably damaging 0.96
R1970:Nf1 UTSW 11 79553961 missense probably benign 0.08
R2059:Nf1 UTSW 11 79556723 missense probably damaging 0.96
R2105:Nf1 UTSW 11 79469826 missense possibly damaging 0.50
R2151:Nf1 UTSW 11 79447570 missense possibly damaging 0.94
R2211:Nf1 UTSW 11 79444064 missense probably benign 0.39
R2497:Nf1 UTSW 11 79443884 missense probably damaging 1.00
R2899:Nf1 UTSW 11 79412758 missense possibly damaging 0.93
R3086:Nf1 UTSW 11 79546986 missense probably damaging 1.00
R3120:Nf1 UTSW 11 79564899 missense probably damaging 0.99
R3744:Nf1 UTSW 11 79548747 missense probably benign 0.23
R3801:Nf1 UTSW 11 79559521 missense probably null 0.98
R3804:Nf1 UTSW 11 79559521 missense probably null 0.98
R4212:Nf1 UTSW 11 79469798 missense probably damaging 1.00
R4298:Nf1 UTSW 11 79384244 missense probably damaging 1.00
R4578:Nf1 UTSW 11 79445759 missense probably damaging 1.00
R4579:Nf1 UTSW 11 79468757 missense probably damaging 1.00
R4587:Nf1 UTSW 11 79536037 critical splice donor site probably null
R4793:Nf1 UTSW 11 79447572 missense probably damaging 1.00
R4834:Nf1 UTSW 11 79546297 missense probably damaging 1.00
R4863:Nf1 UTSW 11 79409409 missense probably damaging 1.00
R4967:Nf1 UTSW 11 79565553 critical splice donor site probably null
R4971:Nf1 UTSW 11 79444643 missense probably damaging 1.00
R5034:Nf1 UTSW 11 79444150 missense probably damaging 0.98
R5036:Nf1 UTSW 11 79446864 missense probably damaging 1.00
R5207:Nf1 UTSW 11 79454189 missense probably damaging 1.00
R5348:Nf1 UTSW 11 79564899 missense probably damaging 1.00
R5356:Nf1 UTSW 11 79473456 missense possibly damaging 0.94
R5444:Nf1 UTSW 11 79443959 missense possibly damaging 0.94
R5533:Nf1 UTSW 11 79445789 missense probably damaging 0.99
R5918:Nf1 UTSW 11 79569222 intron probably benign
R5978:Nf1 UTSW 11 79540419 missense probably damaging 1.00
R6140:Nf1 UTSW 11 79473320 splice site probably null
R6195:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6233:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6257:Nf1 UTSW 11 79549491 missense probably damaging 1.00
R6258:Nf1 UTSW 11 79565755 intron probably null
R6756:Nf1 UTSW 11 79444587 splice site probably null
R6878:Nf1 UTSW 11 79434882 missense probably damaging 1.00
R6959:Nf1 UTSW 11 79549468 missense probably damaging 0.98
X0052:Nf1 UTSW 11 79559416 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGGCTAATGATTAAGCTTCAAAGG -3'
(R):5'- AAAGCAGGTCCTCTGAACAC -3'

Sequencing Primer
(F):5'- TGATAGCCAAATACAAGCCATTTG -3'
(R):5'- GGTCCTCTGAACACAACATCTAAG -3'
Posted On2018-02-27