Incidental Mutation 'R6217:Fcmr'
ID503759
Institutional Source Beutler Lab
Gene Symbol Fcmr
Ensembl Gene ENSMUSG00000042474
Gene NameFc fragment of IgM receptor
Synonyms1810037B05Rik, FcmuR, Faim3
MMRRC Submission 044350-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6217 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location130865669-130880791 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 130878323 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 339 (R339W)
Ref Sequence ENSEMBL: ENSMUSP00000048303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038829] [ENSMUST00000121040] [ENSMUST00000187650] [ENSMUST00000191279]
Predicted Effect probably damaging
Transcript: ENSMUST00000038829
AA Change: R339W

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000048303
Gene: ENSMUSG00000042474
AA Change: R339W

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:V-set 21 122 1.3e-10 PFAM
low complexity region 212 223 N/A INTRINSIC
transmembrane domain 264 283 N/A INTRINSIC
low complexity region 285 311 N/A INTRINSIC
low complexity region 344 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121040
SMART Domains Protein: ENSMUSP00000113064
Gene: ENSMUSG00000026420

DomainStartEndE-ValueType
low complexity region 44 56 N/A INTRINSIC
IL10 76 219 1.14e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149355
Predicted Effect probably benign
Transcript: ENSMUST00000187650
SMART Domains Protein: ENSMUSP00000140149
Gene: ENSMUSG00000026420

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IL10 37 180 5.4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191279
SMART Domains Protein: ENSMUSP00000140821
Gene: ENSMUSG00000026420

DomainStartEndE-ValueType
low complexity region 44 56 N/A INTRINSIC
Blast:IL10 76 118 2e-21 BLAST
SCOP:d2ilk__ 80 119 2e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fc receptors specifically bind to the Fc region of immunoglobulins (Igs) to mediate the unique functions of each Ig class. FAIM3 encodes an Fc receptor for IgM (see MIM 147020) (Kubagawa et al., 2009 [PubMed 19858324]; Shima et al., 2010 [PubMed 20042454]).[supplied by OMIM, Jul 2010]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit a slight decrease in B cell numbers reduced sensitivity to Gal-induced liver damage, increased granulocyte production of ROS and increased sensitivity to infection by Listeria monocytogenes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik G A 6: 40,926,085 P118S possibly damaging Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
Adamts20 T C 15: 94,338,715 D808G probably benign Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arsk T A 13: 76,091,816 Q46L unknown Het
Asnsd1 A G 1: 53,348,028 F147L probably benign Het
Atp5a1 T A 18: 77,781,356 S427T probably benign Het
Atp6v1b2 A C 8: 69,109,878 probably null Het
AU021092 T A 16: 5,212,186 T322S possibly damaging Het
Bcl7c A T 7: 127,708,526 M1K probably null Het
Cacna1i T C 15: 80,389,132 V1673A probably damaging Het
Ccdc146 A T 5: 21,317,902 probably null Het
Cdc7 A G 5: 106,972,794 D122G probably damaging Het
Cfap46 CCTTCTTCT CCTTCT 7: 139,638,900 probably benign Het
Chd3 T A 11: 69,345,535 Q1950L probably damaging Het
Cutc T C 19: 43,759,997 L111S probably damaging Het
Cyp2j6 A G 4: 96,518,161 F458L probably damaging Het
Ddhd1 T C 14: 45,619,514 probably null Het
Dstyk T C 1: 132,459,939 S804P probably damaging Het
Ech1 A G 7: 28,831,836 D283G possibly damaging Het
Exosc10 A G 4: 148,582,311 probably null Het
Fam160b2 T C 14: 70,591,758 probably null Het
Fancg A C 4: 43,010,084 V5G probably benign Het
Fbxo11 A G 17: 88,008,904 V394A probably benign Het
Fsip2 T A 2: 82,988,418 L4832M possibly damaging Het
Gab1 A G 8: 80,791,608 V125A possibly damaging Het
Gabrr1 A T 4: 33,149,026 probably null Het
Gon4l T C 3: 88,892,661 V871A possibly damaging Het
Hspg2 A G 4: 137,540,248 T2056A probably damaging Het
Lrrc3 T A 10: 77,901,009 T198S probably benign Het
Lsamp A T 16: 42,134,312 E174V possibly damaging Het
Ltbr C T 6: 125,307,454 V342M probably damaging Het
Muc16 A T 9: 18,655,446 S1926T unknown Het
Ntn1 C A 11: 68,213,332 V497F possibly damaging Het
Olfr181 T C 16: 58,926,514 D19G probably benign Het
Olfr700 A T 7: 106,806,072 L130Q probably damaging Het
Olfr936 A T 9: 39,046,743 *270R probably null Het
Osmr T C 15: 6,823,566 Y615C probably damaging Het
Pcdhgb2 T C 18: 37,690,001 V15A possibly damaging Het
Pkd2l2 A G 18: 34,414,680 N162S probably benign Het
Ppp1r12a G A 10: 108,240,184 probably null Het
Prtg C T 9: 72,904,794 P899S probably damaging Het
Ptprn A T 1: 75,248,166 S912R probably damaging Het
Rex2 A G 4: 147,057,474 T140A possibly damaging Het
Ryr2 T G 13: 11,834,078 D339A probably damaging Het
Sf3b1 C T 1: 55,007,518 R289H probably damaging Het
Slc17a9 A G 2: 180,737,662 D309G probably benign Het
Slc4a10 A G 2: 62,303,951 R1004G probably benign Het
Sprr2f A T 3: 92,366,059 Q55L unknown Het
Syne1 C T 10: 5,293,761 G2801D probably benign Het
Tenm3 A T 8: 48,293,665 V1026D probably damaging Het
Ticam1 A T 17: 56,270,730 I455N probably damaging Het
Tmem161b A G 13: 84,251,244 I6M possibly damaging Het
Ubn1 A G 16: 5,077,232 E714G probably damaging Het
Ush2a T G 1: 188,743,454 probably null Het
Usp19 G A 9: 108,500,144 V874M probably damaging Het
Vmn2r106 T C 17: 20,268,239 T633A probably benign Het
Vmn2r75 A T 7: 86,166,167 probably benign Het
Zfyve27 T C 19: 42,189,577 V386A probably damaging Het
Zscan20 A T 4: 128,604,534 W24R probably damaging Het
Other mutations in Fcmr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01638:Fcmr APN 1 130875122 missense probably benign 0.06
IGL01652:Fcmr APN 1 130878507 missense probably benign 0.25
IGL02106:Fcmr APN 1 130875135 missense probably benign
IGL03270:Fcmr APN 1 130876042 missense possibly damaging 0.63
R1635:Fcmr UTSW 1 130876185 splice site probably null
R1651:Fcmr UTSW 1 130878251 missense probably benign
R1728:Fcmr UTSW 1 130875974 missense probably benign
R1728:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1729:Fcmr UTSW 1 130875974 missense probably benign
R1729:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1730:Fcmr UTSW 1 130875974 missense probably benign
R1730:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1739:Fcmr UTSW 1 130875974 missense probably benign
R1739:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1762:Fcmr UTSW 1 130875974 missense probably benign
R1762:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1783:Fcmr UTSW 1 130875974 missense probably benign
R1783:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1784:Fcmr UTSW 1 130875974 missense probably benign
R1784:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1785:Fcmr UTSW 1 130875974 missense probably benign
R1785:Fcmr UTSW 1 130878269 missense probably benign 0.00
R2037:Fcmr UTSW 1 130878333 missense possibly damaging 0.61
R6111:Fcmr UTSW 1 130877829 missense probably damaging 0.96
R6538:Fcmr UTSW 1 130875025 missense possibly damaging 0.72
R6712:Fcmr UTSW 1 130877851 missense probably damaging 0.99
R6965:Fcmr UTSW 1 130875987 missense possibly damaging 0.65
X0025:Fcmr UTSW 1 130874267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGTGTCTGATGCCATG -3'
(R):5'- CGAGGGCTTCAATTTAGGGAC -3'

Sequencing Primer
(F):5'- GTGTCTGATGCCATGCCCTTC -3'
(R):5'- AGGGCTTCAATTTAGGGACTGGATAC -3'
Posted On2018-02-27