Incidental Mutation 'R6217:Gon4l'
ID503764
Institutional Source Beutler Lab
Gene Symbol Gon4l
Ensembl Gene ENSMUSG00000054199
Gene Namegon-4-like (C.elegans)
Synonyms2610100B20Rik, 1500041I23Rik
MMRRC Submission 044350-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.803) question?
Stock #R6217 (G1)
Quality Score133.008
Status Validated
Chromosome3
Chromosomal Location88835231-88910103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88892661 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 871 (V871A)
Ref Sequence ENSEMBL: ENSMUSP00000103122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081695] [ENSMUST00000090942] [ENSMUST00000107498]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081695
AA Change: V871A

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080397
Gene: ENSMUSG00000054199
AA Change: V871A

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000090942
AA Change: V872A

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000088461
Gene: ENSMUSG00000054199
AA Change: V872A

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 241 257 N/A INTRINSIC
low complexity region 349 378 N/A INTRINSIC
low complexity region 433 440 N/A INTRINSIC
low complexity region 528 543 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
Blast:SANT 814 866 2e-23 BLAST
low complexity region 962 976 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1419 1435 N/A INTRINSIC
low complexity region 1453 1498 N/A INTRINSIC
low complexity region 1508 1542 N/A INTRINSIC
Pfam:PAH 1654 1700 2.1e-8 PFAM
low complexity region 1801 1812 N/A INTRINSIC
coiled coil region 1920 1944 N/A INTRINSIC
low complexity region 2086 2095 N/A INTRINSIC
SANT 2154 2205 2.2e-1 SMART
low complexity region 2208 2223 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107498
AA Change: V871A

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103122
Gene: ENSMUSG00000054199
AA Change: V871A

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198251
Predicted Effect probably benign
Transcript: ENSMUST00000212694
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (59/61)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit arrested B cell development at the early pro-B cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik G A 6: 40,926,085 P118S possibly damaging Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
Adamts20 T C 15: 94,338,715 D808G probably benign Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arsk T A 13: 76,091,816 Q46L unknown Het
Asnsd1 A G 1: 53,348,028 F147L probably benign Het
Atp5a1 T A 18: 77,781,356 S427T probably benign Het
Atp6v1b2 A C 8: 69,109,878 probably null Het
AU021092 T A 16: 5,212,186 T322S possibly damaging Het
Bcl7c A T 7: 127,708,526 M1K probably null Het
Cacna1i T C 15: 80,389,132 V1673A probably damaging Het
Ccdc146 A T 5: 21,317,902 probably null Het
Cdc7 A G 5: 106,972,794 D122G probably damaging Het
Cfap46 CCTTCTTCT CCTTCT 7: 139,638,900 probably benign Het
Chd3 T A 11: 69,345,535 Q1950L probably damaging Het
Cutc T C 19: 43,759,997 L111S probably damaging Het
Cyp2j6 A G 4: 96,518,161 F458L probably damaging Het
Ddhd1 T C 14: 45,619,514 probably null Het
Dstyk T C 1: 132,459,939 S804P probably damaging Het
Ech1 A G 7: 28,831,836 D283G possibly damaging Het
Exosc10 A G 4: 148,582,311 probably null Het
Fam160b2 T C 14: 70,591,758 probably null Het
Fancg A C 4: 43,010,084 V5G probably benign Het
Fbxo11 A G 17: 88,008,904 V394A probably benign Het
Fcmr C T 1: 130,878,323 R339W probably damaging Het
Fsip2 T A 2: 82,988,418 L4832M possibly damaging Het
Gab1 A G 8: 80,791,608 V125A possibly damaging Het
Gabrr1 A T 4: 33,149,026 probably null Het
Hspg2 A G 4: 137,540,248 T2056A probably damaging Het
Lrrc3 T A 10: 77,901,009 T198S probably benign Het
Lsamp A T 16: 42,134,312 E174V possibly damaging Het
Ltbr C T 6: 125,307,454 V342M probably damaging Het
Muc16 A T 9: 18,655,446 S1926T unknown Het
Ntn1 C A 11: 68,213,332 V497F possibly damaging Het
Olfr181 T C 16: 58,926,514 D19G probably benign Het
Olfr700 A T 7: 106,806,072 L130Q probably damaging Het
Olfr936 A T 9: 39,046,743 *270R probably null Het
Osmr T C 15: 6,823,566 Y615C probably damaging Het
Pcdhgb2 T C 18: 37,690,001 V15A possibly damaging Het
Pkd2l2 A G 18: 34,414,680 N162S probably benign Het
Ppp1r12a G A 10: 108,240,184 probably null Het
Prtg C T 9: 72,904,794 P899S probably damaging Het
Ptprn A T 1: 75,248,166 S912R probably damaging Het
Rex2 A G 4: 147,057,474 T140A possibly damaging Het
Ryr2 T G 13: 11,834,078 D339A probably damaging Het
Sf3b1 C T 1: 55,007,518 R289H probably damaging Het
Slc17a9 A G 2: 180,737,662 D309G probably benign Het
Slc4a10 A G 2: 62,303,951 R1004G probably benign Het
Sprr2f A T 3: 92,366,059 Q55L unknown Het
Syne1 C T 10: 5,293,761 G2801D probably benign Het
Tenm3 A T 8: 48,293,665 V1026D probably damaging Het
Ticam1 A T 17: 56,270,730 I455N probably damaging Het
Tmem161b A G 13: 84,251,244 I6M possibly damaging Het
Ubn1 A G 16: 5,077,232 E714G probably damaging Het
Ush2a T G 1: 188,743,454 probably null Het
Usp19 G A 9: 108,500,144 V874M probably damaging Het
Vmn2r106 T C 17: 20,268,239 T633A probably benign Het
Vmn2r75 A T 7: 86,166,167 probably benign Het
Zfyve27 T C 19: 42,189,577 V386A probably damaging Het
Zscan20 A T 4: 128,604,534 W24R probably damaging Het
Other mutations in Gon4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Gon4l APN 3 88857185 missense probably damaging 1.00
IGL02002:Gon4l APN 3 88895336 missense possibly damaging 0.46
IGL02065:Gon4l APN 3 88857210 missense probably null 1.00
IGL02283:Gon4l APN 3 88895364 missense probably damaging 0.99
IGL02669:Gon4l APN 3 88895499 missense probably damaging 1.00
IGL03222:Gon4l APN 3 88895643 missense possibly damaging 0.56
IGL03385:Gon4l APN 3 88907543 missense probably benign 0.10
PIT4581001:Gon4l UTSW 3 88895514 missense probably damaging 1.00
R0020:Gon4l UTSW 3 88858937 missense probably damaging 1.00
R0115:Gon4l UTSW 3 88895682 missense probably damaging 1.00
R0173:Gon4l UTSW 3 88858403 missense probably damaging 1.00
R0270:Gon4l UTSW 3 88858400 missense probably damaging 1.00
R0961:Gon4l UTSW 3 88898096 splice site probably benign
R1017:Gon4l UTSW 3 88858496 missense probably benign 0.15
R1163:Gon4l UTSW 3 88892535 missense probably damaging 1.00
R1729:Gon4l UTSW 3 88903098 missense probably damaging 1.00
R1764:Gon4l UTSW 3 88892599 missense probably damaging 1.00
R1861:Gon4l UTSW 3 88895487 missense probably damaging 1.00
R2141:Gon4l UTSW 3 88887595 missense possibly damaging 0.66
R2347:Gon4l UTSW 3 88863517 missense probably damaging 1.00
R2402:Gon4l UTSW 3 88859043 missense probably damaging 1.00
R2842:Gon4l UTSW 3 88895487 missense probably damaging 1.00
R4375:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4376:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4377:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4569:Gon4l UTSW 3 88910090 intron probably benign
R4650:Gon4l UTSW 3 88863552 missense possibly damaging 0.94
R4859:Gon4l UTSW 3 88895348 missense probably benign 0.00
R4901:Gon4l UTSW 3 88908151 missense possibly damaging 0.50
R4998:Gon4l UTSW 3 88899998 missense probably damaging 1.00
R5059:Gon4l UTSW 3 88900012 missense probably benign 0.00
R5217:Gon4l UTSW 3 88887575 missense probably damaging 1.00
R5269:Gon4l UTSW 3 88895528 missense probably benign
R5279:Gon4l UTSW 3 88887637 missense probably benign
R5283:Gon4l UTSW 3 88887590 missense probably damaging 1.00
R5386:Gon4l UTSW 3 88858496 missense probably benign 0.15
R5433:Gon4l UTSW 3 88896225 missense possibly damaging 0.93
R5583:Gon4l UTSW 3 88899971 missense probably damaging 1.00
R5695:Gon4l UTSW 3 88896216 frame shift probably null
R5921:Gon4l UTSW 3 88909947 intron probably benign
R6003:Gon4l UTSW 3 88896093 missense probably damaging 0.99
R6063:Gon4l UTSW 3 88899999 missense probably damaging 1.00
R6273:Gon4l UTSW 3 88855849 missense probably damaging 1.00
R6280:Gon4l UTSW 3 88890888 missense probably damaging 1.00
R6790:Gon4l UTSW 3 88858998 missense probably damaging 1.00
R6829:Gon4l UTSW 3 88880106 missense possibly damaging 0.96
R6891:Gon4l UTSW 3 88858866 intron probably null
R7128:Gon4l UTSW 3 88895692 missense possibly damaging 0.94
R7315:Gon4l UTSW 3 88895179 missense probably benign 0.00
R7355:Gon4l UTSW 3 88863520 missense probably damaging 1.00
R7426:Gon4l UTSW 3 88907522 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACTCTCTAAGGGTGTGGGAGG -3'
(R):5'- AGTTCCAACCCTGCTGAGTAAC -3'

Sequencing Primer
(F):5'- GTTGAAGAGCTCCTTGCAGAACC -3'
(R):5'- TGCTGAGTAACACCACAGTAAG -3'
Posted On2018-02-27