Incidental Mutation 'R6218:Prrc2b'
ID503820
Institutional Source Beutler Lab
Gene Symbol Prrc2b
Ensembl Gene ENSMUSG00000039262
Gene Nameproline-rich coiled-coil 2B
Synonyms5830434P21Rik, Bat2l
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6218 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location32151082-32234537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32208811 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 712 (Y712H)
Ref Sequence ENSEMBL: ENSMUSP00000064892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036691] [ENSMUST00000069817]
Predicted Effect probably damaging
Transcript: ENSMUST00000036691
AA Change: Y712H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035734
Gene: ENSMUSG00000039262
AA Change: Y712H

DomainStartEndE-ValueType
Pfam:BAT2_N 1 194 2.7e-85 PFAM
low complexity region 359 374 N/A INTRINSIC
low complexity region 388 394 N/A INTRINSIC
low complexity region 413 424 N/A INTRINSIC
coiled coil region 494 544 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 638 656 N/A INTRINSIC
low complexity region 885 900 N/A INTRINSIC
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1112 1126 N/A INTRINSIC
low complexity region 1218 1233 N/A INTRINSIC
low complexity region 1257 1275 N/A INTRINSIC
low complexity region 1402 1421 N/A INTRINSIC
low complexity region 1425 1437 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000069817
AA Change: Y712H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064892
Gene: ENSMUSG00000039262
AA Change: Y712H

DomainStartEndE-ValueType
Pfam:BAT2_N 1 191 3.1e-65 PFAM
low complexity region 359 374 N/A INTRINSIC
low complexity region 388 394 N/A INTRINSIC
low complexity region 413 424 N/A INTRINSIC
coiled coil region 494 544 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 638 656 N/A INTRINSIC
low complexity region 960 977 N/A INTRINSIC
low complexity region 1004 1018 N/A INTRINSIC
low complexity region 1070 1094 N/A INTRINSIC
low complexity region 1307 1325 N/A INTRINSIC
low complexity region 1388 1401 N/A INTRINSIC
low complexity region 1413 1426 N/A INTRINSIC
low complexity region 1572 1587 N/A INTRINSIC
low complexity region 1678 1693 N/A INTRINSIC
low complexity region 1798 1812 N/A INTRINSIC
low complexity region 1904 1919 N/A INTRINSIC
low complexity region 1943 1961 N/A INTRINSIC
low complexity region 2088 2107 N/A INTRINSIC
low complexity region 2111 2123 N/A INTRINSIC
low complexity region 2161 2174 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123270
Predicted Effect unknown
Transcript: ENSMUST00000132459
AA Change: Y639H
SMART Domains Protein: ENSMUSP00000116429
Gene: ENSMUSG00000039262
AA Change: Y639H

DomainStartEndE-ValueType
Pfam:BAT2_N 1 119 9.8e-24 PFAM
low complexity region 287 302 N/A INTRINSIC
low complexity region 316 322 N/A INTRINSIC
low complexity region 341 352 N/A INTRINSIC
coiled coil region 421 471 N/A INTRINSIC
low complexity region 528 549 N/A INTRINSIC
low complexity region 566 584 N/A INTRINSIC
low complexity region 813 828 N/A INTRINSIC
low complexity region 920 935 N/A INTRINSIC
low complexity region 1040 1054 N/A INTRINSIC
low complexity region 1146 1161 N/A INTRINSIC
low complexity region 1185 1203 N/A INTRINSIC
low complexity region 1330 1349 N/A INTRINSIC
low complexity region 1353 1365 N/A INTRINSIC
low complexity region 1403 1416 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156313
SMART Domains Protein: ENSMUSP00000114994
Gene: ENSMUSG00000039262

DomainStartEndE-ValueType
low complexity region 125 140 N/A INTRINSIC
low complexity region 231 246 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik G T 11: 99,837,904 Q38K probably benign Het
9930111J21Rik2 A T 11: 49,019,307 N766K probably benign Het
Adam15 A C 3: 89,343,883 I505S probably benign Het
Apc2 T C 10: 80,306,420 M391T probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bclaf1 A G 10: 20,334,628 S840G probably benign Het
Cacna2d4 A G 6: 119,239,060 Y96C probably damaging Het
Cald1 CAAAA CAAA 6: 34,747,928 probably null Het
Ddhd1 A G 14: 45,614,176 L141P probably damaging Het
Dnaaf3 A T 7: 4,523,672 S469T probably benign Het
Dzip3 A T 16: 48,958,465 M323K possibly damaging Het
E430018J23Rik C T 7: 127,393,409 A10T possibly damaging Het
Eci2 T A 13: 34,993,065 probably null Het
Fam109b T A 15: 82,343,716 H145Q probably benign Het
Fam227b A T 2: 126,126,962 V64E probably damaging Het
Galnt2 A G 8: 124,343,315 I524V probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm14548 A T 7: 3,894,032 S602T possibly damaging Het
Gm3443 T A 19: 21,555,746 S25T probably damaging Het
Gpr22 T A 12: 31,711,617 K14* probably null Het
Grip1 T C 10: 119,986,346 S405P possibly damaging Het
Helz2 C A 2: 181,232,294 V2136L probably benign Het
Helz2 T C 2: 181,235,945 H1020R probably damaging Het
Il1f5 G A 2: 24,277,490 probably benign Het
Iqsec1 T A 6: 90,689,635 S607C probably damaging Het
Klhl2 A T 8: 64,752,767 Y373* probably null Het
L3mbtl3 T C 10: 26,292,747 I595V unknown Het
Large2 T C 2: 92,370,636 D65G probably damaging Het
Lrrfip1 T C 1: 91,082,159 Y122H probably damaging Het
Map1b A T 13: 99,433,206 D1002E unknown Het
Mink1 C T 11: 70,598,894 T59I possibly damaging Het
Mrvi1 G A 7: 110,876,905 T819M probably benign Het
Myo7b T C 18: 31,959,454 N2097D probably benign Het
Nbea C A 3: 55,628,484 C2893F probably damaging Het
Nlgn1 A T 3: 25,436,093 V490E probably damaging Het
Olfr1230 G T 2: 89,296,962 H103N probably damaging Het
Olfr131 A G 17: 38,082,729 M83T probably damaging Het
Olfr1318 T C 2: 112,156,356 I135T probably damaging Het
Olfr1369-ps1 G A 13: 21,116,231 E180K probably damaging Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pdcl3 T C 1: 38,988,071 probably null Het
Pkp1 T C 1: 135,879,908 K541E probably damaging Het
Plekhh2 G A 17: 84,591,564 V990I probably benign Het
Ppp1r3a A T 6: 14,718,431 V828D probably damaging Het
Prune2 T C 19: 17,121,562 S1477P probably benign Het
Psma5 A G 3: 108,279,802 K239R probably benign Het
Rhobtb1 G C 10: 69,270,456 A284P probably benign Het
Samsn1 G A 16: 75,945,274 noncoding transcript Het
Scel A G 14: 103,572,042 T273A probably benign Het
Slc22a5 T A 11: 53,891,618 probably benign Het
Slc25a37 A T 14: 69,249,504 M110K possibly damaging Het
Slc6a2 A T 8: 92,981,981 M242L probably benign Het
Slc8a3 C A 12: 81,199,567 W904L probably benign Het
Ss18l1 G A 2: 180,055,112 V109I probably benign Het
Tbx5 C T 5: 119,853,598 H245Y probably damaging Het
Thumpd2 C A 17: 81,052,913 L244F probably damaging Het
Tmem107 T A 11: 69,071,415 V66E probably damaging Het
Tnr T C 1: 159,888,314 V882A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttbk1 A G 17: 46,470,807 V340A possibly damaging Het
Veph1 T C 3: 66,255,060 E59G probably damaging Het
Vmn1r234 T A 17: 21,229,721 M299K possibly damaging Het
Vps13b T C 15: 35,770,464 Y2018H probably benign Het
Zbtb11 A G 16: 55,998,073 E620G probably benign Het
Zfp418 A G 7: 7,182,628 H530R possibly damaging Het
Other mutations in Prrc2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Prrc2b APN 2 32208719 missense probably damaging 1.00
IGL00846:Prrc2b APN 2 32199097 splice site probably benign
IGL00977:Prrc2b APN 2 32213810 missense probably benign 0.05
IGL01372:Prrc2b APN 2 32223930 missense probably damaging 0.99
IGL01993:Prrc2b APN 2 32224045 missense possibly damaging 0.47
IGL02097:Prrc2b APN 2 32191501 splice site probably benign
IGL02165:Prrc2b APN 2 32214640 missense probably damaging 1.00
IGL02184:Prrc2b APN 2 32221455 missense probably benign 0.19
IGL02238:Prrc2b APN 2 32213417 missense probably damaging 1.00
IGL02338:Prrc2b APN 2 32214035 missense probably benign 0.01
IGL02399:Prrc2b APN 2 32226961 nonsense probably null
IGL02597:Prrc2b APN 2 32219613 missense probably damaging 1.00
IGL02729:Prrc2b APN 2 32208758 missense probably damaging 0.99
IGL02743:Prrc2b APN 2 32194429 missense probably damaging 1.00
IGL02815:Prrc2b APN 2 32204253 missense probably damaging 1.00
IGL03159:Prrc2b APN 2 32194486 missense probably damaging 0.98
FR4304:Prrc2b UTSW 2 32221167 missense probably damaging 1.00
R0082:Prrc2b UTSW 2 32212298 splice site probably benign
R0105:Prrc2b UTSW 2 32213311 nonsense probably null
R0276:Prrc2b UTSW 2 32219654 missense probably damaging 0.97
R0325:Prrc2b UTSW 2 32199091 missense probably damaging 1.00
R0436:Prrc2b UTSW 2 32230660 missense probably damaging 1.00
R0595:Prrc2b UTSW 2 32183177 missense probably damaging 1.00
R0607:Prrc2b UTSW 2 32213870 missense probably damaging 0.99
R0650:Prrc2b UTSW 2 32229255 splice site probably benign
R1282:Prrc2b UTSW 2 32223444 missense probably damaging 0.96
R1421:Prrc2b UTSW 2 32200978 missense possibly damaging 0.65
R1452:Prrc2b UTSW 2 32194985 missense probably damaging 1.00
R1535:Prrc2b UTSW 2 32204289 missense probably benign 0.06
R1709:Prrc2b UTSW 2 32194461 missense probably damaging 1.00
R1710:Prrc2b UTSW 2 32212222 missense probably damaging 0.99
R2094:Prrc2b UTSW 2 32182570 missense probably damaging 1.00
R2202:Prrc2b UTSW 2 32223464 missense probably damaging 1.00
R2203:Prrc2b UTSW 2 32223464 missense probably damaging 1.00
R2204:Prrc2b UTSW 2 32223464 missense probably damaging 1.00
R2428:Prrc2b UTSW 2 32216055 missense probably benign 0.00
R2435:Prrc2b UTSW 2 32219729 missense probably damaging 0.99
R3439:Prrc2b UTSW 2 32206347 missense probably benign 0.01
R4175:Prrc2b UTSW 2 32218808 intron probably benign
R4710:Prrc2b UTSW 2 32193857 missense possibly damaging 0.80
R4728:Prrc2b UTSW 2 32230625 missense probably damaging 1.00
R4791:Prrc2b UTSW 2 32217339 splice site probably null
R4876:Prrc2b UTSW 2 32214200 missense probably benign 0.00
R4908:Prrc2b UTSW 2 32226318 missense possibly damaging 0.94
R4997:Prrc2b UTSW 2 32222311 missense probably damaging 1.00
R5240:Prrc2b UTSW 2 32206396 missense probably benign 0.01
R5276:Prrc2b UTSW 2 32214722 missense probably benign 0.09
R5455:Prrc2b UTSW 2 32221343 critical splice acceptor site probably null
R5821:Prrc2b UTSW 2 32212132 missense probably damaging 0.99
R5835:Prrc2b UTSW 2 32206473 missense probably benign 0.18
R5958:Prrc2b UTSW 2 32212080 missense possibly damaging 0.89
R6052:Prrc2b UTSW 2 32212285 missense possibly damaging 0.92
R6428:Prrc2b UTSW 2 32226496 intron probably null
R6505:Prrc2b UTSW 2 32222320 missense probably damaging 1.00
R6812:Prrc2b UTSW 2 32213141 missense probably benign 0.30
R6826:Prrc2b UTSW 2 32222288 critical splice acceptor site probably null
R6827:Prrc2b UTSW 2 32200951 missense probably benign 0.37
R7021:Prrc2b UTSW 2 32221486 missense probably damaging 1.00
R7078:Prrc2b UTSW 2 32213519 missense probably benign 0.01
R7081:Prrc2b UTSW 2 32213063 missense probably benign 0.12
R7101:Prrc2b UTSW 2 32226993 missense possibly damaging 0.68
R7215:Prrc2b UTSW 2 32229297 missense probably damaging 1.00
R7228:Prrc2b UTSW 2 32214306 nonsense probably null
Z1088:Prrc2b UTSW 2 32214429 missense probably benign 0.03
Z1088:Prrc2b UTSW 2 32216732 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGAGCAGCTGTACAAGATG -3'
(R):5'- GCTAGAGAGACTCACCAGCAAG -3'

Sequencing Primer
(F):5'- CTGTACAAGATGCAGCACTGGC -3'
(R):5'- GTCTCAGCCTCTCAAGTGATGAAATG -3'
Posted On2018-02-27