Incidental Mutation 'R6218:Bclaf1'
ID503847
Institutional Source Beutler Lab
Gene Symbol Bclaf1
Ensembl Gene ENSMUSG00000037608
Gene NameBCL2-associated transcription factor 1
Synonyms5730534O06Rik, 2810454G14Rik, 2700025J07Rik, 2610102K23Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6218 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location20312469-20344613 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20334628 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 840 (S840G)
Ref Sequence ENSEMBL: ENSMUSP00000140623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043881] [ENSMUST00000092678] [ENSMUST00000185800] [ENSMUST00000186100] [ENSMUST00000189158] [ENSMUST00000190156] [ENSMUST00000191438]
Predicted Effect probably benign
Transcript: ENSMUST00000043881
AA Change: S842G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000043583
Gene: ENSMUSG00000037608
AA Change: S842G

DomainStartEndE-ValueType
low complexity region 3 94 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 108 766 1.6e-181 PFAM
low complexity region 793 824 N/A INTRINSIC
low complexity region 861 874 N/A INTRINSIC
low complexity region 898 919 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092678
SMART Domains Protein: ENSMUSP00000090349
Gene: ENSMUSG00000037608

DomainStartEndE-ValueType
low complexity region 3 94 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 108 789 5.4e-191 PFAM
low complexity region 812 825 N/A INTRINSIC
low complexity region 849 870 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185800
AA Change: S840G

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140623
Gene: ENSMUSG00000037608
AA Change: S840G

DomainStartEndE-ValueType
low complexity region 3 92 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 106 787 7.2e-191 PFAM
low complexity region 791 822 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
low complexity region 896 917 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186100
SMART Domains Protein: ENSMUSP00000140101
Gene: ENSMUSG00000037608

DomainStartEndE-ValueType
low complexity region 3 94 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 108 742 6.4e-177 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188546
Predicted Effect probably benign
Transcript: ENSMUST00000189158
Predicted Effect probably benign
Transcript: ENSMUST00000190156
SMART Domains Protein: ENSMUSP00000140428
Gene: ENSMUSG00000037608

DomainStartEndE-ValueType
low complexity region 3 92 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 106 740 4.2e-180 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191143
Predicted Effect probably benign
Transcript: ENSMUST00000191438
SMART Domains Protein: ENSMUSP00000140702
Gene: ENSMUSG00000037608

DomainStartEndE-ValueType
Pfam:THRAP3_BCLAF1 1 502 1.3e-140 PFAM
low complexity region 525 538 N/A INTRINSIC
low complexity region 562 583 N/A INTRINSIC
Meta Mutation Damage Score 0.314 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional repressor that interacts with several members of the BCL2 family of proteins. Overexpression of this protein induces apoptosis, which can be suppressed by co-expression of BCL2 proteins. The protein localizes to dot-like structures throughout the nucleus, and redistributes to a zone near the nuclear envelope in cells undergoing apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, impaired lung development, and T cell and B cell homeostasis abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik G T 11: 99,837,904 Q38K probably benign Het
9930111J21Rik2 A T 11: 49,019,307 N766K probably benign Het
Adam15 A C 3: 89,343,883 I505S probably benign Het
Apc2 T C 10: 80,306,420 M391T probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cacna2d4 A G 6: 119,239,060 Y96C probably damaging Het
Cald1 CAAAA CAAA 6: 34,747,928 probably null Het
Ddhd1 A G 14: 45,614,176 L141P probably damaging Het
Dnaaf3 A T 7: 4,523,672 S469T probably benign Het
Dzip3 A T 16: 48,958,465 M323K possibly damaging Het
E430018J23Rik C T 7: 127,393,409 A10T possibly damaging Het
Eci2 T A 13: 34,993,065 probably null Het
Fam109b T A 15: 82,343,716 H145Q probably benign Het
Fam227b A T 2: 126,126,962 V64E probably damaging Het
Galnt2 A G 8: 124,343,315 I524V probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm14548 A T 7: 3,894,032 S602T possibly damaging Het
Gm3443 T A 19: 21,555,746 S25T probably damaging Het
Gpr22 T A 12: 31,711,617 K14* probably null Het
Grip1 T C 10: 119,986,346 S405P possibly damaging Het
Helz2 T C 2: 181,235,945 H1020R probably damaging Het
Helz2 C A 2: 181,232,294 V2136L probably benign Het
Il1f5 G A 2: 24,277,490 probably benign Het
Iqsec1 T A 6: 90,689,635 S607C probably damaging Het
Klhl2 A T 8: 64,752,767 Y373* probably null Het
L3mbtl3 T C 10: 26,292,747 I595V unknown Het
Large2 T C 2: 92,370,636 D65G probably damaging Het
Lrrfip1 T C 1: 91,082,159 Y122H probably damaging Het
Map1b A T 13: 99,433,206 D1002E unknown Het
Mink1 C T 11: 70,598,894 T59I possibly damaging Het
Mrvi1 G A 7: 110,876,905 T819M probably benign Het
Myo7b T C 18: 31,959,454 N2097D probably benign Het
Nbea C A 3: 55,628,484 C2893F probably damaging Het
Nlgn1 A T 3: 25,436,093 V490E probably damaging Het
Olfr1230 G T 2: 89,296,962 H103N probably damaging Het
Olfr131 A G 17: 38,082,729 M83T probably damaging Het
Olfr1318 T C 2: 112,156,356 I135T probably damaging Het
Olfr1369-ps1 G A 13: 21,116,231 E180K probably damaging Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pdcl3 T C 1: 38,988,071 probably null Het
Pkp1 T C 1: 135,879,908 K541E probably damaging Het
Plekhh2 G A 17: 84,591,564 V990I probably benign Het
Ppp1r3a A T 6: 14,718,431 V828D probably damaging Het
Prrc2b T C 2: 32,208,811 Y712H probably damaging Het
Prune2 T C 19: 17,121,562 S1477P probably benign Het
Psma5 A G 3: 108,279,802 K239R probably benign Het
Rhobtb1 G C 10: 69,270,456 A284P probably benign Het
Samsn1 G A 16: 75,945,274 noncoding transcript Het
Scel A G 14: 103,572,042 T273A probably benign Het
Slc22a5 T A 11: 53,891,618 probably benign Het
Slc25a37 A T 14: 69,249,504 M110K possibly damaging Het
Slc6a2 A T 8: 92,981,981 M242L probably benign Het
Slc8a3 C A 12: 81,199,567 W904L probably benign Het
Ss18l1 G A 2: 180,055,112 V109I probably benign Het
Tbx5 C T 5: 119,853,598 H245Y probably damaging Het
Thumpd2 C A 17: 81,052,913 L244F probably damaging Het
Tmem107 T A 11: 69,071,415 V66E probably damaging Het
Tnr T C 1: 159,888,314 V882A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttbk1 A G 17: 46,470,807 V340A possibly damaging Het
Veph1 T C 3: 66,255,060 E59G probably damaging Het
Vmn1r234 T A 17: 21,229,721 M299K possibly damaging Het
Vps13b T C 15: 35,770,464 Y2018H probably benign Het
Zbtb11 A G 16: 55,998,073 E620G probably benign Het
Zfp418 A G 7: 7,182,628 H530R possibly damaging Het
Other mutations in Bclaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Bclaf1 APN 10 20325999 missense probably damaging 0.99
IGL01087:Bclaf1 APN 10 20325310 missense probably damaging 0.99
IGL02001:Bclaf1 APN 10 20323016 unclassified probably benign
IGL02380:Bclaf1 APN 10 20325367 missense possibly damaging 0.93
IGL02618:Bclaf1 APN 10 20323528 missense probably damaging 1.00
R0629:Bclaf1 UTSW 10 20333426 missense probably damaging 1.00
R0884:Bclaf1 UTSW 10 20322076 nonsense probably null
R1013:Bclaf1 UTSW 10 20332076 splice site probably benign
R1611:Bclaf1 UTSW 10 20323252 unclassified probably benign
R2228:Bclaf1 UTSW 10 20339878 utr 3 prime probably benign
R3689:Bclaf1 UTSW 10 20325397 missense possibly damaging 0.84
R3690:Bclaf1 UTSW 10 20325397 missense possibly damaging 0.84
R4290:Bclaf1 UTSW 10 20323778 missense probably damaging 1.00
R4292:Bclaf1 UTSW 10 20323778 missense probably damaging 1.00
R4831:Bclaf1 UTSW 10 20322126 unclassified probably benign
R5238:Bclaf1 UTSW 10 20332384 intron probably benign
R5254:Bclaf1 UTSW 10 20323536 missense possibly damaging 0.71
R5354:Bclaf1 UTSW 10 20333532 missense probably damaging 1.00
R5386:Bclaf1 UTSW 10 20325592 missense possibly damaging 0.95
R5712:Bclaf1 UTSW 10 20333531 missense probably damaging 1.00
R5982:Bclaf1 UTSW 10 20323063 nonsense probably null
R6147:Bclaf1 UTSW 10 20323425 missense possibly damaging 0.93
R6284:Bclaf1 UTSW 10 20322160 intron probably null
R6738:Bclaf1 UTSW 10 20323769 missense possibly damaging 0.91
R7085:Bclaf1 UTSW 10 20322022 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTACCTGATCCATCCTCAGTG -3'
(R):5'- GAACCAGAGGGACCCATAACTG -3'

Sequencing Primer
(F):5'- ATCCATCCTCAGTGGCTGTGAAG -3'
(R):5'- CCCCTAGGATGTTTGGAA -3'
Posted On2018-02-27