Incidental Mutation 'R6218:Ttbk1'
ID503875
Institutional Source Beutler Lab
Gene Symbol Ttbk1
Ensembl Gene ENSMUSG00000015599
Gene Nametau tubulin kinase 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.387) question?
Stock #R6218 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location46442448-46487675 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46470807 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 340 (V340A)
Ref Sequence ENSEMBL: ENSMUSP00000044580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047034] [ENSMUST00000225808]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047034
AA Change: V340A

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000044580
Gene: ENSMUSG00000015599
AA Change: V340A

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 34 293 3.4e-21 PFAM
Pfam:Pkinase 34 305 1.7e-33 PFAM
low complexity region 320 334 N/A INTRINSIC
low complexity region 371 395 N/A INTRINSIC
low complexity region 570 593 N/A INTRINSIC
low complexity region 611 624 N/A INTRINSIC
low complexity region 633 653 N/A INTRINSIC
low complexity region 697 709 N/A INTRINSIC
coiled coil region 729 776 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 893 913 N/A INTRINSIC
low complexity region 945 962 N/A INTRINSIC
low complexity region 1090 1115 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Predicted Effect probably benign
Transcript: ENSMUST00000225808
AA Change: V340A

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Summary:This gene belongs to the casein kinase 1 superfamily. The encoded protein is a neuron-specific, serine/threonine and tyrosine kinase, which regulates phosphorylation of tau, a protein that associates with microtubule assemblies and stabilizes them. Genetic variants in this gene are associated with Alzheimer's disease. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik G T 11: 99,837,904 Q38K probably benign Het
9930111J21Rik2 A T 11: 49,019,307 N766K probably benign Het
Adam15 A C 3: 89,343,883 I505S probably benign Het
Apc2 T C 10: 80,306,420 M391T probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bclaf1 A G 10: 20,334,628 S840G probably benign Het
Cacna2d4 A G 6: 119,239,060 Y96C probably damaging Het
Cald1 CAAAA CAAA 6: 34,747,928 probably null Het
Ddhd1 A G 14: 45,614,176 L141P probably damaging Het
Dnaaf3 A T 7: 4,523,672 S469T probably benign Het
Dzip3 A T 16: 48,958,465 M323K possibly damaging Het
E430018J23Rik C T 7: 127,393,409 A10T possibly damaging Het
Eci2 T A 13: 34,993,065 probably null Het
Fam109b T A 15: 82,343,716 H145Q probably benign Het
Fam227b A T 2: 126,126,962 V64E probably damaging Het
Galnt2 A G 8: 124,343,315 I524V probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm14548 A T 7: 3,894,032 S602T possibly damaging Het
Gm3443 T A 19: 21,555,746 S25T probably damaging Het
Gpr22 T A 12: 31,711,617 K14* probably null Het
Grip1 T C 10: 119,986,346 S405P possibly damaging Het
Helz2 T C 2: 181,235,945 H1020R probably damaging Het
Helz2 C A 2: 181,232,294 V2136L probably benign Het
Il1f5 G A 2: 24,277,490 probably benign Het
Iqsec1 T A 6: 90,689,635 S607C probably damaging Het
Klhl2 A T 8: 64,752,767 Y373* probably null Het
L3mbtl3 T C 10: 26,292,747 I595V unknown Het
Large2 T C 2: 92,370,636 D65G probably damaging Het
Lrrfip1 T C 1: 91,082,159 Y122H probably damaging Het
Map1b A T 13: 99,433,206 D1002E unknown Het
Mink1 C T 11: 70,598,894 T59I possibly damaging Het
Mrvi1 G A 7: 110,876,905 T819M probably benign Het
Myo7b T C 18: 31,959,454 N2097D probably benign Het
Nbea C A 3: 55,628,484 C2893F probably damaging Het
Nlgn1 A T 3: 25,436,093 V490E probably damaging Het
Olfr1230 G T 2: 89,296,962 H103N probably damaging Het
Olfr131 A G 17: 38,082,729 M83T probably damaging Het
Olfr1318 T C 2: 112,156,356 I135T probably damaging Het
Olfr1369-ps1 G A 13: 21,116,231 E180K probably damaging Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pdcl3 T C 1: 38,988,071 probably null Het
Pkp1 T C 1: 135,879,908 K541E probably damaging Het
Plekhh2 G A 17: 84,591,564 V990I probably benign Het
Ppp1r3a A T 6: 14,718,431 V828D probably damaging Het
Prrc2b T C 2: 32,208,811 Y712H probably damaging Het
Prune2 T C 19: 17,121,562 S1477P probably benign Het
Psma5 A G 3: 108,279,802 K239R probably benign Het
Rhobtb1 G C 10: 69,270,456 A284P probably benign Het
Samsn1 G A 16: 75,945,274 noncoding transcript Het
Scel A G 14: 103,572,042 T273A probably benign Het
Slc22a5 T A 11: 53,891,618 probably benign Het
Slc25a37 A T 14: 69,249,504 M110K possibly damaging Het
Slc6a2 A T 8: 92,981,981 M242L probably benign Het
Slc8a3 C A 12: 81,199,567 W904L probably benign Het
Ss18l1 G A 2: 180,055,112 V109I probably benign Het
Tbx5 C T 5: 119,853,598 H245Y probably damaging Het
Thumpd2 C A 17: 81,052,913 L244F probably damaging Het
Tmem107 T A 11: 69,071,415 V66E probably damaging Het
Tnr T C 1: 159,888,314 V882A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Veph1 T C 3: 66,255,060 E59G probably damaging Het
Vmn1r234 T A 17: 21,229,721 M299K possibly damaging Het
Vps13b T C 15: 35,770,464 Y2018H probably benign Het
Zbtb11 A G 16: 55,998,073 E620G probably benign Het
Zfp418 A G 7: 7,182,628 H530R possibly damaging Het
Other mutations in Ttbk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01869:Ttbk1 APN 17 46447063 missense probably damaging 1.00
IGL02469:Ttbk1 APN 17 46470630 missense possibly damaging 0.77
IGL02826:Ttbk1 APN 17 46470660 missense probably benign
IGL02874:Ttbk1 APN 17 46470225 missense probably benign 0.10
IGL02948:Ttbk1 APN 17 46446330 missense probably benign 0.44
IGL03037:Ttbk1 APN 17 46446330 missense probably benign 0.44
R0165:Ttbk1 UTSW 17 46478938 missense possibly damaging 0.70
R1186:Ttbk1 UTSW 17 46467131 missense probably damaging 1.00
R1228:Ttbk1 UTSW 17 46476712 critical splice donor site probably null
R1423:Ttbk1 UTSW 17 46446154 splice site probably benign
R1477:Ttbk1 UTSW 17 46476799 missense probably benign 0.05
R1960:Ttbk1 UTSW 17 46480224 missense probably damaging 0.99
R1961:Ttbk1 UTSW 17 46480224 missense probably damaging 0.99
R4043:Ttbk1 UTSW 17 46446762 missense probably benign 0.21
R4190:Ttbk1 UTSW 17 46479247 missense probably damaging 1.00
R4192:Ttbk1 UTSW 17 46479247 missense probably damaging 1.00
R4193:Ttbk1 UTSW 17 46479247 missense probably damaging 1.00
R4660:Ttbk1 UTSW 17 46477788 nonsense probably null
R5383:Ttbk1 UTSW 17 46467416 missense probably damaging 1.00
R5385:Ttbk1 UTSW 17 46447632 missense probably benign 0.00
R5715:Ttbk1 UTSW 17 46479207 missense probably damaging 0.99
R6263:Ttbk1 UTSW 17 46467262 missense probably damaging 1.00
R6471:Ttbk1 UTSW 17 46467277 missense probably benign
R6537:Ttbk1 UTSW 17 46470310 missense probably damaging 0.98
R6552:Ttbk1 UTSW 17 46478962 missense probably benign 0.14
X0066:Ttbk1 UTSW 17 46446856 missense possibly damaging 0.74
Z1088:Ttbk1 UTSW 17 46446325 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- CTTTGCCAATGTTGATGCGCAG -3'
(R):5'- CTTGTAGGCAGGGATGGCAATG -3'

Sequencing Primer
(F):5'- GCGGTTGACATCTGTCTCC -3'
(R):5'- GCAATGGGCCTCTTCTCTGG -3'
Posted On2018-02-27