Incidental Mutation 'R6220:Rasgrp1'
ID503933
Institutional Source Beutler Lab
Gene Symbol Rasgrp1
Ensembl Gene ENSMUSG00000027347
Gene NameRAS guanyl releasing protein 1
Synonyms
MMRRC Submission 044352-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R6220 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location117279993-117343001 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 117284929 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 726 (W726*)
Ref Sequence ENSEMBL: ENSMUSP00000136423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102534] [ENSMUST00000172901] [ENSMUST00000173252] [ENSMUST00000173541] [ENSMUST00000174770] [ENSMUST00000178884]
Predicted Effect probably null
Transcript: ENSMUST00000102534
AA Change: W726*
SMART Domains Protein: ENSMUSP00000099593
Gene: ENSMUSG00000027347
AA Change: W726*

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_5 474 499 3.2e-6 PFAM
Pfam:EF-hand_6 474 502 5e-6 PFAM
C1 542 591 5.77e-16 SMART
PDB:4L9U|B 740 791 2e-23 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000172901
SMART Domains Protein: ENSMUSP00000133449
Gene: ENSMUSG00000027347

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_6 442 467 1.2e-5 PFAM
C1 507 556 5.77e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173252
SMART Domains Protein: ENSMUSP00000134592
Gene: ENSMUSG00000027347

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_6 442 467 1.1e-5 PFAM
Pfam:C1_1 507 539 3.4e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173541
AA Change: W691*
SMART Domains Protein: ENSMUSP00000134027
Gene: ENSMUSG00000027347
AA Change: W691*

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_5 441 464 1.6e-5 PFAM
Pfam:EF-hand_6 442 467 1.6e-5 PFAM
C1 507 556 5.77e-16 SMART
PDB:4L9U|B 705 756 2e-23 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000174770
SMART Domains Protein: ENSMUSP00000134167
Gene: ENSMUSG00000027347

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Predicted Effect probably null
Transcript: ENSMUST00000178884
AA Change: W726*
SMART Domains Protein: ENSMUSP00000136423
Gene: ENSMUSG00000027347
AA Change: W726*

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_5 474 499 3.2e-6 PFAM
C1 542 591 5.77e-16 SMART
PDB:4L9U|B 740 791 2e-23 PDB
Meta Mutation Damage Score 0.63 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a family of genes characterized by the presence of a Ras superfamily guanine nucleotide exchange factor (GEF) domain. It functions as a diacylglycerol (DAG)-regulated nucleotide exchange factor specifically activating Ras through the exchange of bound GDP for GTP. It activates the Erk/MAP kinase cascade and regulates T-cells and B-cells development, homeostasis and differentiation. Alternatively spliced transcript variants encoding different isoforms have been identified. Altered expression of the different isoforms of this protein may be a cause of susceptibility to systemic lupus erythematosus (SLE). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous and targeted null mutations exhibit a lymphoproliferative autoimmune syndrome in which T cells fail to activate Ras or proliferate after antigen exposure, defects in positive selection, and enlarged spleen and lymph nodes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik T C 19: 45,846,115 E618G possibly damaging Het
Abhd16b A G 2: 181,493,785 D160G probably damaging Het
Acap1 A G 11: 69,889,679 F15S probably damaging Het
Adam30 A T 3: 98,161,309 S153C probably damaging Het
Afp A T 5: 90,504,410 D420V possibly damaging Het
Ak9 T A 10: 41,370,099 H729Q unknown Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bcr A G 10: 75,062,292 T423A probably benign Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Ctns T C 11: 73,193,128 T23A probably benign Het
Ddx54 T A 5: 120,620,689 N332K probably benign Het
Dysf T A 6: 84,149,745 I1344N probably damaging Het
Elovl3 A T 19: 46,134,500 M172L probably benign Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Filip1l T A 16: 57,569,989 N313K probably benign Het
Foxp2 C A 6: 15,437,948 T716K probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10645 A G 8: 83,165,757 probably benign Het
Gm10735 T C 13: 113,041,496 probably benign Het
Gm4847 A T 1: 166,634,972 D316E probably damaging Het
Gorasp2 T C 2: 70,690,790 L388P probably damaging Het
Heatr5b A G 17: 78,773,677 L1382P probably damaging Het
Herc1 A G 9: 66,433,788 Y1729C probably damaging Het
Ifi207 A T 1: 173,729,546 L542H probably damaging Het
Ighv3-5 T A 12: 114,262,718 N96I probably damaging Het
Isl1 T C 13: 116,303,267 T182A probably benign Het
Jph4 T C 14: 55,110,085 E421G probably benign Het
Lrrc45 T C 11: 120,719,527 I488T probably benign Het
Mroh8 A G 2: 157,233,163 I471T probably benign Het
Ms4a2 A T 19: 11,617,563 D96E probably damaging Het
Mst1r T A 9: 107,907,348 N68K probably benign Het
Myo18b A G 5: 112,757,507 M2075T possibly damaging Het
Neb T C 2: 52,270,972 K2229R probably null Het
Nkx6-3 T A 8: 23,153,971 probably null Het
Nlrp1a C A 11: 71,142,338 S10I probably benign Het
Npas2 A T 1: 39,336,061 T487S probably benign Het
Nrxn1 G C 17: 91,088,476 T84R probably benign Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh18 A G 3: 49,745,251 C921R probably damaging Het
Pcdha9 A G 18: 36,998,478 Y200C probably damaging Het
Pknox1 A T 17: 31,603,203 R315* probably null Het
Rassf8 G A 6: 145,817,133 R402H probably damaging Het
Rev3l T A 10: 39,822,779 Y1091N probably damaging Het
Riok3 T G 18: 12,149,551 V349G probably damaging Het
Rps18 A T 17: 33,955,136 V15E probably damaging Het
Rptor A T 11: 119,897,442 Y1323F possibly damaging Het
Rspry1 T C 8: 94,658,750 C437R probably damaging Het
Sema5a T A 15: 32,686,729 Y996N probably damaging Het
Smarcad1 A G 6: 65,114,329 I1011M probably benign Het
Supv3l1 A T 10: 62,439,021 M295K possibly damaging Het
Sv2c T C 13: 95,976,626 D605G probably damaging Het
Teddm1b G A 1: 153,875,201 W252* probably null Het
Tes T A 6: 17,086,196 C29* probably null Het
Thsd4 A G 9: 59,982,747 W856R probably damaging Het
Treml4 A T 17: 48,264,848 D93V possibly damaging Het
Trim66 T C 7: 109,483,093 T218A probably damaging Het
Tssk5 T C 15: 76,373,773 D128G probably damaging Het
Ubr3 T A 2: 70,020,475 W1746R probably damaging Het
Vmn2r11 T C 5: 109,053,568 I357V probably benign Het
Vmn2r87 A T 10: 130,479,938 D86E probably benign Het
Zfp184 T G 13: 21,960,207 H694Q probably damaging Het
Zranb3 A C 1: 127,999,404 F341L probably benign Het
Other mutations in Rasgrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Rasgrp1 APN 2 117305791 nonsense probably null
IGL00901:Rasgrp1 APN 2 117285130 missense probably damaging 0.96
IGL01083:Rasgrp1 APN 2 117285068 missense probably benign 0.22
IGL01325:Rasgrp1 APN 2 117298529 missense probably damaging 1.00
IGL01520:Rasgrp1 APN 2 117288663 missense probably damaging 1.00
IGL01776:Rasgrp1 APN 2 117286840 critical splice donor site probably null
IGL01780:Rasgrp1 APN 2 117284878 missense probably benign 0.00
IGL01859:Rasgrp1 APN 2 117289418 missense probably benign 0.00
IGL01892:Rasgrp1 APN 2 117293842 missense probably damaging 1.00
IGL02068:Rasgrp1 APN 2 117300578 splice site probably benign
IGL02684:Rasgrp1 APN 2 117282576 missense probably benign 0.03
grouper UTSW 2 117302004 nonsense probably null
Haddock UTSW 2 117291895 missense probably damaging 0.99
naejangsan UTSW 2 117291792 nonsense probably null
sea_bass UTSW 2 117282654 missense probably benign 0.02
venutian UTSW 2 117284929 nonsense probably null
R0067:Rasgrp1 UTSW 2 117294820 missense probably damaging 1.00
R0067:Rasgrp1 UTSW 2 117294820 missense probably damaging 1.00
R0538:Rasgrp1 UTSW 2 117284947 missense probably benign 0.42
R0786:Rasgrp1 UTSW 2 117300499 missense probably benign
R1068:Rasgrp1 UTSW 2 117282576 missense probably benign 0.03
R1165:Rasgrp1 UTSW 2 117284939 missense possibly damaging 0.49
R1491:Rasgrp1 UTSW 2 117282619 nonsense probably null
R1707:Rasgrp1 UTSW 2 117298547 missense probably damaging 1.00
R1869:Rasgrp1 UTSW 2 117290347 missense probably damaging 1.00
R2214:Rasgrp1 UTSW 2 117285165 missense probably damaging 0.98
R2425:Rasgrp1 UTSW 2 117289450 critical splice acceptor site probably null
R3236:Rasgrp1 UTSW 2 117291812 missense probably benign 0.00
R3915:Rasgrp1 UTSW 2 117288641 missense probably damaging 1.00
R4079:Rasgrp1 UTSW 2 117285029 missense probably benign 0.19
R4163:Rasgrp1 UTSW 2 117282654 missense probably benign 0.02
R4781:Rasgrp1 UTSW 2 117291709 missense probably benign 0.04
R4782:Rasgrp1 UTSW 2 117284875 missense probably benign 0.00
R5028:Rasgrp1 UTSW 2 117302004 nonsense probably null
R6019:Rasgrp1 UTSW 2 117291895 missense probably damaging 0.99
R6294:Rasgrp1 UTSW 2 117291792 nonsense probably null
R6335:Rasgrp1 UTSW 2 117293870 missense probably damaging 0.99
R6948:Rasgrp1 UTSW 2 117298604 missense probably damaging 0.99
R7165:Rasgrp1 UTSW 2 117338404 missense probably benign 0.02
R7246:Rasgrp1 UTSW 2 117338354 nonsense probably null
R7372:Rasgrp1 UTSW 2 117285154 missense probably benign 0.01
R7400:Rasgrp1 UTSW 2 117298545 missense probably damaging 1.00
R7432:Rasgrp1 UTSW 2 117287943 missense probably damaging 1.00
R7448:Rasgrp1 UTSW 2 117287943 missense probably damaging 1.00
R7448:Rasgrp1 UTSW 2 117291697 missense possibly damaging 0.78
R7449:Rasgrp1 UTSW 2 117287943 missense probably damaging 1.00
R7450:Rasgrp1 UTSW 2 117287943 missense probably damaging 1.00
R7475:Rasgrp1 UTSW 2 117286108 missense probably benign
R7487:Rasgrp1 UTSW 2 117287943 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGTCTGCTGACCTAACCTAG -3'
(R):5'- CCCAGAAAATTTCAGTTCGGC -3'

Sequencing Primer
(F):5'- GCTGACCTAACCTAGTAATCATCTTG -3'
(R):5'- TGAAGAGGACTGTTGCCCAC -3'
Posted On2018-02-27